Vinculin cDNA ORF Clone, Human, C-Myc tag

Cat: HG10019-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Vinculin Reagents
CRO Services
Product recommended

All Vinculin Reagents
Vinculin cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
3201 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human vinculin (VCL), transcript variant 2 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Restriction Sites
KpnI(three restriction sites) + XbaI (6kb + 2.83kb + 0.37kb + 0.06kb)
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Vinculin cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Vinculin cDNA ORF Clone, Human, C-Myc tag Validated Images
Human VCL/Vinculin Gene Plasmid Map 5640
Vinculin cDNA ORF Clone, Human, C-Myc tag Alternative Names
CMD1W cDNA ORF Clone, Human;CMH15 cDNA ORF Clone, Human;HEL114 cDNA ORF Clone, Human;MV cDNA ORF Clone, Human;MVCL cDNA ORF Clone, Human
Vinculin Background Information

Vinculin (VCL) is a cytoskeletal protein that is closely related to both cell-matrix interactions and cell-cell junctions. VCL is a membrane-cytoskeletal protein in focal adhesion plaques that is involved in linkage of integrin adhesion molecules to the actin cytoskeleton. The protein contains an acidic N-terminal domain and a basic C-terminal domain separated by a proline-rich middle segment. This protein has multi-ligand properties and has been found to interact with a number of microfilament associated proteins, such as talin, a-actinin, and paxillin, which reportedly bind to either the head or tail domains of vinculin.

Full Name
vinculin
References
  • Massoumi R, et al. (2001) Leukotriene D(4) affects localisation of vinculin in intestinal epithelial cells via distinct tyrosine kinase and protein kinase C controlled events. J Cell Sci. 114(10): 1925-34.
  • Turner CE, et al. (1994) Primary sequence of paxillin contains putative SH2 and SH3 domain binding motifs and multiple LIM domains: identification of a vinculin and pp125Fak-binding region. J Cell Sci. 107 (6): 1583-91.
  • Strasser P, et al. (1993) Variable and constant regions in the C-terminus of vinculin and metavinculin: cloning and expression of fragments in E. coli. FEBS Lett. 317: 189-194.
  • Vinculin cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Vinculin cDNA ORF Clone in Cloning Vector, Mouse MG50773-G
    Vinculin cDNA ORF Clone, Mouse, untagged MG50773-UT
    Vinculin Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50773-ACGLN
    Vinculin cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50773-ACG
    Vinculin cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50773-ANG
    Vinculin cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50773-ACR
    Vinculin cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50773-ANR
    Vinculin cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50773-CF
    Vinculin cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50773-NF
    Vinculin cDNA ORF Clone, Mouse, C-His tag MG50773-CH
    Vinculin cDNA ORF Clone, Mouse, N-His tag MG50773-NH
    Vinculin cDNA ORF Clone, Mouse, C-HA tag MG50773-CY
    Vinculin cDNA ORF Clone, Mouse, N-HA tag MG50773-NY
    Vinculin cDNA ORF Clone, Mouse, C-Myc tag MG50773-CM
    Vinculin cDNA ORF Clone, Mouse, N-Myc tag MG50773-NM
    Vinculin qPCR Primer Pairs, Mouse MP200747

    Vinculin cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Vinculin cDNA ORF Clone in Cloning Vector, Human HG10019-M
    Vinculin cDNA ORF Clone, Human, untagged HG10019-UT
    Vinculin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10019-ACGLN
    Vinculin cDNA ORF Clone, Human, C-GFPSpark® tag HG10019-ACG
    Vinculin cDNA ORF Clone, Human, N-GFPSpark® tag HG10019-ANG
    Vinculin cDNA ORF Clone, Human, C-OFPSpark® tag HG10019-ACR
    Vinculin cDNA ORF Clone, Human, N-OFPSpark® tag HG10019-ANR
    Vinculin cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10019-CF
    Vinculin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10019-NF
    Vinculin cDNA ORF Clone, Human, C-His tag HG10019-CH
    Vinculin cDNA ORF Clone, Human, N-His tag HG10019-NH
    Vinculin cDNA ORF Clone, Human, C-HA tag HG10019-CY
    Vinculin cDNA ORF Clone, Human, N-HA tag HG10019-NY
    Vinculin cDNA ORF Clone, Human, N-Myc tag HG10019-NM
    Vinculin qPCR Primer Pairs, Human HP100116
    info info
    添加购物车成功! 添加购物车失败!