Quick Order

Human VCL/Vinculin transcript variant 2 Gene ORF cDNA clone expression plasmid, C-HA tag

    DatasheetReviewsRelated ProductsProtocols
    Human VCL cDNA Clone Product Information
    NCBI RefSeq:NM_003373.3
    RefSeq ORF Size:3201bp
    cDNA Description:Full length Clone DNA of Homo sapiens vinculin (VCL), transcript variant 2 with C terminal HA tag.
    Gene Synonym:VCL, MVCL, CMD1W, Vin
    Species:Human
    Vector:pCMV3-C-HA
    Plasmid:
    Restriction Site:
    Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with VCL qPCR primers for gene expression analysis, HP100116 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Human VCL/Vinculin transcript variant 2 Gene ORF cDNA clone expression plasmid, C-HA tag on other vectors
    Human VCL/Vinculin transcript variant 2 Gene ORF cDNA clone expression plasmid, C-GFPSpark tagHG10019-ACG$325
    Human VCL/Vinculin transcript variant 2 Gene ORF cDNA clone expression plasmid, C-OFPSpark tagHG10019-ACR$325
    Human VCL/Vinculin transcript variant 2 Gene ORF cDNA clone expression plasmid, N-GFPSpark tagHG10019-ANG$325
    Human VCL/Vinculin transcript variant 2 Gene ORF cDNA clone expression plasmid, N-OFPSpark tagHG10019-ANR$325
    Human VCL/Vinculin transcript variant 2 Gene ORF cDNA clone expression plasmid, C-Flag tagHG10019-CF$295
    Human VCL/Vinculin transcript variant 2 Gene ORF cDNA clone expression plasmid, C-His tagHG10019-CH$295
    Human VCL/Vinculin transcript variant 2 Gene ORF cDNA clone expression plasmid, C-Myc tagHG10019-CM$295
    Human VCL/Vinculin transcript variant 2 Gene ORF cDNA clone expression plasmid, C-HA tagHG10019-CY$295
    Human VCL/Vinculin transcript variant 2 Gene ORF cDNA clone in cloning vectorHG10019-M$75
    Human VCL/Vinculin transcript variant 2 Gene ORF cDNA clone expression plasmid, C-Flag tagHG10019-M-F$295
    Human VCL/Vinculin transcript variant 2 Gene ORF cDNA clone expression plasmid, N-Flag tagHG10019-NF$295
    Human VCL/Vinculin transcript variant 2 Gene ORF cDNA clone expression plasmid, N-His tagHG10019-NH$295
    Human VCL/Vinculin transcript variant 2 Gene ORF cDNA clone expression plasmid, N-Myc tagHG10019-NM$295
    Human VCL/Vinculin transcript variant 2 Gene ORF cDNA clone expression plasmid, N-HA tagHG10019-NY$295
    Human VCL/Vinculin transcript variant 2 Gene ORF cDNA clone expression plasmidHG10019-UT$295
     Learn more about expression Vectors
    Product nameProduct name
    Background

    Vinculin (VCL) is a cytoskeletal protein that is closely related to both cell-matrix interactions and cell-cell junctions. VCL is a membrane-cytoskeletal protein in focal adhesion plaques that is involved in linkage of integrin adhesion molecules to the actin cytoskeleton. The protein contains an acidic N-terminal domain and a basic C-terminal domain separated by a proline-rich middle segment. This protein has multi-ligand properties and has been found to interact with a number of microfilament associated proteins, such as talin, a-actinin, and paxillin, which reportedly bind to either the head or tail domains of vinculin.

    References
  • Massoumi R, et al. (2001) Leukotriene D(4) affects localisation of vinculin in intestinal epithelial cells via distinct tyrosine kinase and protein kinase C controlled events. J Cell Sci. 114(10): 1925-34.
  • Turner CE, et al. (1994) Primary sequence of paxillin contains putative SH2 and SH3 domain binding motifs and multiple LIM domains: identification of a vinculin and pp125Fak-binding region. J Cell Sci. 107 (6): 1583-91.
  • Strasser P, et al. (1993) Variable and constant regions in the C-terminus of vinculin and metavinculin: cloning and expression of fragments in E. coli. FEBS Lett. 317: 189-194.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"