Quick Order

Human VCL/Vinculin transcript variant 2 Gene ORF cDNA clone expression plasmid, C-HA tag

DatasheetReviewsRelated ProductsProtocols
Human VCL cDNA Clone Product Information
NCBI RefSeq:NM_003373.3
RefSeq ORF Size:3201bp
cDNA Description:Full length Clone DNA of Homo sapiens vinculin (VCL), transcript variant 2 with C terminal HA tag.
Gene Synonym:VCL, MVCL, CMD1W, Vin
Species:Human
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Human VCL/Vinculin transcript variant 2 Gene ORF cDNA clone expression plasmid, C-HA tag on other vectors
Human VCL/Vinculin transcript variant 2 Gene ORF cDNA clone expression plasmid, C-GFPSpark tagHG10019-ACG$325
Human VCL/Vinculin transcript variant 2 Gene ORF cDNA clone expression plasmid, C-OFPSpark tagHG10019-ACR$325
Human VCL/Vinculin transcript variant 2 Gene ORF cDNA clone expression plasmid, N-GFPSpark tagHG10019-ANG$325
Human VCL/Vinculin transcript variant 2 Gene ORF cDNA clone expression plasmid, N-OFPSpark tagHG10019-ANR$325
Human VCL/Vinculin transcript variant 2 Gene ORF cDNA clone expression plasmid, C-Flag tagHG10019-CF$295
Human VCL/Vinculin transcript variant 2 Gene ORF cDNA clone expression plasmid, C-His tagHG10019-CH$295
Human VCL/Vinculin transcript variant 2 Gene ORF cDNA clone expression plasmid, C-Myc tagHG10019-CM$295
Human VCL/Vinculin transcript variant 2 Gene ORF cDNA clone expression plasmid, C-HA tagHG10019-CY$295
Human VCL/Vinculin transcript variant 2 Gene ORF cDNA clone in cloning vectorHG10019-M$75
Human VCL/Vinculin transcript variant 2 Gene ORF cDNA clone expression plasmid, C-Flag tagHG10019-M-F$295
Human VCL/Vinculin transcript variant 2 Gene ORF cDNA clone expression plasmid, N-Flag tagHG10019-NF$295
Human VCL/Vinculin transcript variant 2 Gene ORF cDNA clone expression plasmid, N-His tagHG10019-NH$295
Human VCL/Vinculin transcript variant 2 Gene ORF cDNA clone expression plasmid, N-Myc tagHG10019-NM$295
Human VCL/Vinculin transcript variant 2 Gene ORF cDNA clone expression plasmid, N-HA tagHG10019-NY$295
Human VCL/Vinculin transcript variant 2 Gene ORF cDNA clone expression plasmidHG10019-UT$295
 Learn more about expression Vectors
Product nameProduct name
Background

Vinculin (VCL) is a cytoskeletal protein that is closely related to both cell-matrix interactions and cell-cell junctions. VCL is a membrane-cytoskeletal protein in focal adhesion plaques that is involved in linkage of integrin adhesion molecules to the actin cytoskeleton. The protein contains an acidic N-terminal domain and a basic C-terminal domain separated by a proline-rich middle segment. This protein has multi-ligand properties and has been found to interact with a number of microfilament associated proteins, such as talin, a-actinin, and paxillin, which reportedly bind to either the head or tail domains of vinculin.

References
  • Massoumi R, et al. (2001) Leukotriene D(4) affects localisation of vinculin in intestinal epithelial cells via distinct tyrosine kinase and protein kinase C controlled events. J Cell Sci. 114(10): 1925-34.
  • Turner CE, et al. (1994) Primary sequence of paxillin contains putative SH2 and SH3 domain binding motifs and multiple LIM domains: identification of a vinculin and pp125Fak-binding region. J Cell Sci. 107 (6): 1583-91.
  • Strasser P, et al. (1993) Variable and constant regions in the C-terminus of vinculin and metavinculin: cloning and expression of fragments in E. coli. FEBS Lett. 317: 189-194.
  • Size / Price
    Catalog: HG10019-CY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"