SFRP1 cDNA ORF Clone, Human, untagged

Cat: HG10680-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SFRP1 Reagents
CRO Services
Product recommended

All SFRP1 Reagents
SFRP1 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
939 bp
Description
Full length Clone DNA of Human secreted frizzled-related protein 1.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SFRP1 cDNA ORF Clone, Human, untagged Alternative Names
FRP cDNA ORF Clone, Human;FRP-1 cDNA ORF Clone, Human;FRP1 cDNA ORF Clone, Human;FrzA cDNA ORF Clone, Human;SARP2 cDNA ORF Clone, Human
SFRP1 Background Information

Secreted frizzled-related protein 1, also known as sFRP1, is a 35 kDa prototypical member of the SFRP family. SFRP family consists of five secreted glycoproteins in humans acting as extracellular signaling ligands. Each is approximately 300 amino acids in length and contains a cysteine-rich domain (CRD) that shares 30-50% sequence homology with the CRD of Frizzled (Fz) receptors, a putative signal sequence, and a conserved hydrophilic carboxy-terminal domain. SFRPs act as soluble modulators of Wnt signaling, counteracting Wnt-induced effects at high concentrations and promoting them at lower concentrations. SFRPs are able to bind Wnt proteins and Fz receptors in the extracellular compartment. The interaction between SFRPs and Wnt proteins prevents the latter from binding the Fz receptors. The Wnt pathway plays a key role in embryonic development, cell differentiation and cell proliferation. The deregulation of this critical developmental pathway occurs in several human tumor entities. Mouse sFRP1 is highly expressed in kidney and embryonic heart, as well as in the eye, where it is principally localized to the ciliary body and the lens epithelium.

Full Name
secreted frizzled-related protein 1
References
  • Finch P.W., et al.,(1997), Purification and molecular cloning of a secreted, Frizzled-related antagonist of Wnt action. Proc. Natl. Acad. Sci. U.S.A. 94:6770-6775.
  • Melkonyan H.S., et al., (1997), SARPs: a family of secreted apoptosis-related proteins.Proc. Natl. Acad. Sci. U.S.A. 94:13636-13641.
  • Zhou Z., et al.,(1998), Up-regulation of human secreted frizzled homolog in apoptosis and its down-regulation in breast tumors.Int. J. Cancer 78:95-99.
  • SFRP1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    SFRP1 cDNA ORF Clone in Cloning Vector, Mouse MG50033-M
    SFRP1 cDNA ORF Clone, Mouse, untagged MG50033-UT
    SFRP1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50033-ACGLN
    SFRP1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50033-ACG
    SFRP1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50033-ACR
    SFRP1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50033-CF
    SFRP1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50033-NF
    SFRP1 cDNA ORF Clone, Mouse, C-His tag MG50033-CH
    SFRP1 cDNA ORF Clone, Mouse, N-His tag MG50033-NH
    SFRP1 cDNA ORF Clone, Mouse, C-HA tag MG50033-CY
    SFRP1 cDNA ORF Clone, Mouse, N-HA tag MG50033-NY
    SFRP1 cDNA ORF Clone, Mouse, C-Myc tag MG50033-CM
    SFRP1 cDNA ORF Clone, Mouse, N-Myc tag MG50033-NM
    SFRP1 qPCR Primer Pairs, Mouse MP200033

    SFRP1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    SFRP1 cDNA ORF Clone in Cloning Vector, Human HG10680-U
    SFRP1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10680-ACG
    SFRP1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10680-ACGLN
    SFRP1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10680-ACR
    SFRP1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10680-CF
    SFRP1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10680-NF
    SFRP1 cDNA ORF Clone, Human, C-His tag HG10680-CH
    SFRP1 cDNA ORF Clone, Human, N-His tag HG10680-NH
    SFRP1 cDNA ORF Clone, Human, C-HA tag HG10680-CY
    SFRP1 cDNA ORF Clone, Human, N-HA tag HG10680-NY
    SFRP1 cDNA ORF Clone, Human, C-Myc tag HG10680-CM
    SFRP1 cDNA ORF Clone, Human, N-Myc tag HG10680-NM
    SFRP1 qPCR Primer Pairs, Human HP100877
    info info
    添加购物车成功! 添加购物车失败!