Quick Order

Human respiratory syncytial virus (RSV) (subtype A, strain A2) glycoprotein G / RSV-G (Codon Optimized) ORF mammalian expression plasmid, N-His tag

  • Ferret TNF-alpha/TNFA/TNFSF2 Gene Plasmid Map 5629
DatasheetReviewsRelated ProductsProtocols
RSV RSV-G cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:942 bp
cDNA Description:Full length Clone DNA of Human RSV (subtype A, strain A2) glycoprotein G / RSV-G with N terminal His tag.
Gene Synonym:G, HRSVgp07
Species:RSV
Vector:pCMV3-N-His
Plasmid:pCMV3-His-RSV-G(A-A2)
Restriction Site:KpnI + XbaI(6kb+0.94kb)
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with P03423.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Human respiratory syncytial virus (RSV) (subtype A, strain A2) glycoprotein G / RSV-G (Codon Optimized) ORF mammalian expression plasmid, N-His tag on other vectors
Human respiratory syncytial virus (RSV) (subtype A, strain A2) glycoprotein G / RSV-G ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-taggedVG40038-ACG$325
Human respiratory syncytial virus (RSV) (subtype A, strain A2) glycoprotein G / RSV-G (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40038-ACR$325
Human respiratory syncytial virus (RSV) (subtype A, strain A2) glycoprotein G / RSV-G (Codon Optimized) ORF mammalian expression plasmid, N-GFPSpark tagVG40038-ANG$325
Human respiratory syncytial virus (RSV) (subtype A, strain A2) glycoprotein G / RSV-G (Codon Optimized) ORF mammalian expression plasmid, N-OFPSpark tagVG40038-ANR$325
Human respiratory syncytial virus (RSV) (subtype A, strain A2) glycoprotein G / RSV-G ORF mammalian expression plasmid (Codon Optimized), C-Flag tagVG40038-CF$295
Human respiratory syncytial virus (RSV) (subtype A, strain A2) glycoprotein G / RSV-G (Codon Optimized) ORF mammalian expression plasmid, C-His tagVG40038-CH$295
Human respiratory syncytial virus (RSV) (subtype A, strain A2) glycoprotein G / RSV-G (Codon Optimized) ORF mammalian expression plasmid, C-Myc tagVG40038-CM$295
Human respiratory syncytial virus (RSV) (subtype A, strain A2) glycoprotein G / RSV-G (Codon Optimized) ORF mammalian expression plasmid, C-HA tagVG40038-CY$295
Human respiratory syncytial virus (RSV) (subtype A, strain A2) glycoprotein G / RSV-G ORF mammalian expression plasmid (Codon Optimized)VG40038-G$95
Human respiratory syncytial virus (RSV) (subtype A, strain A2) glycoprotein G / RSV-G (Codon Optimized) ORF mammalian expression plasmid, N-Flag tagVG40038-NF$295
Human respiratory syncytial virus (RSV) (subtype A, strain A2) glycoprotein G / RSV-G (Codon Optimized) ORF mammalian expression plasmid, N-His tagVG40038-NH$295
Human respiratory syncytial virus (RSV) (subtype A, strain A2) glycoprotein G / RSV-G ORF mammalian expression plasmid (Codon Optimized), N-Myc-taggedVG40038-NM$295
Human respiratory syncytial virus (RSV) (subtype A, strain A2) glycoprotein G / RSV-G (Codon Optimized) ORF mammalian expression plasmid, N-HA tagVG40038-NY$295
Human respiratory syncytial virus (RSV) (subtype A, strain A2) glycoprotein G / RSV-G ORF mammalian expression plasmid (Codon Optimized)VG40038-UT$295
 Learn more about expression Vectors
Product nameProduct name
Background

Human respiratory syncytial virus (HRSV) is the most common etiological agent of acute lower respiratory tract disease in infants and can cause repeated infections throughout life. It is classified within the genus pneumovirus of the family paramyxoviridae. Like other members of the family, HRSV has two major surface glycoproteins (G and F) that play important roles in the initial stages of the infectious cycle. HRSV G protein is a type II glycoprotein of 289-299 amino acids (depending on the virus strain) with a signal/anchor hydrophobic domain and is extensively modified by the addition of both N-and O-linked oligosaccharides to achieve the mature form of 80-90 kDa. The C-terminal ectodomain of the G protein has a central region and four cysteines which are conserved in all HRSV isolates and have been proposed as the putative receptor binding site. The G protein mediates attachment of the virus to the host cell membrane by interacting with heparan sulfate, initiating the infection. As similar to mucins in amino acid compositions, the RSV G protein can interact with host CX3CR1, the receptor for the CX3C chemokine fractalkine, and thus modulates the immune response and facilitate infection. Secreted glycoprotein G helps RSV escape antibody-dependent restriction of replication by acting as an antigen decoy and by modulating the activity of leukocytes bearing Fcgamma receptors. Unlike the other paramyxovirus attachment proteins, HRSV-G lacks both neuraminidase and hemagglutinating activities.

References
  • Martin-Gallardo A. et al., 1993, J Gen Virol. 74 : 453-8.
  • Jose AM. et al.,1997, J Gen Virol. 78: 2411-8.
  • Feldman SA. et al., 1999, J Virol. 73: 6610-7.
  • García-Beato R. et al., 2000, J Gen Virol. 81: 919-27.
  • Zlateva KT. et al., 2004, J Virol. 78: 4675-83.
  • Trento A. et al., 2006, J Virol. 80: 975-84.
  • Size / Price
    Catalog: VG40038-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    AvailabilityIn Stock
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"