PXN cDNA ORF Clone, Human, C-Myc tag

Cat: HG10095-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PXN Reagents
CRO Services
Product recommended

All PXN Reagents
PXN cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1674 bp
Description
Full length Clone DNA of Human paxillin, transcript variant 1 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PXN Background Information
Full Name
paxillin

PXN cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PXN cDNA ORF Clone in Cloning Vector, Mouse MG57630-U
PXN cDNA ORF Clone, Mouse, untagged MG57630-UT
PXN cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57630-ACG
PXN Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57630-ACGLN
PXN cDNA ORF Clone, Mouse, N-GFPSpark® tag MG57630-ANG
PXN cDNA ORF Clone, Mouse, C-OFPSpark® tag MG57630-ACR
PXN cDNA ORF Clone, Mouse, N-OFPSpark® tag MG57630-ANR
PXN cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG57630-CF
PXN cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG57630-NF
PXN cDNA ORF Clone, Mouse, C-His tag MG57630-CH
PXN cDNA ORF Clone, Mouse, N-His tag MG57630-NH
PXN cDNA ORF Clone, Mouse, C-HA tag MG57630-CY
PXN cDNA ORF Clone, Mouse, N-HA tag MG57630-NY
PXN cDNA ORF Clone, Mouse, C-Myc tag MG57630-CM
PXN cDNA ORF Clone, Mouse, N-Myc tag MG57630-NM

PXN cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PXN cDNA ORF Clone in Cloning Vector, Human HG10095-M
PXN cDNA ORF Clone, Human, untagged HG10095-UT
PXN Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10095-ACGLN
PXN cDNA ORF Clone, Human, C-GFPSpark® tag HG10095-ACG
PXN cDNA ORF Clone, Human, N-GFPSpark® tag HG10095-ANG
PXN cDNA ORF Clone, Human, C-OFPSpark® tag HG10095-ACR
PXN cDNA ORF Clone, Human, N-OFPSpark® tag HG10095-ANR
PXN cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10095-CF
PXN cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10095-NF
PXN cDNA ORF Clone, Human, C-His tag HG10095-CH
PXN cDNA ORF Clone, Human, N-His tag HG10095-NH
PXN cDNA ORF Clone, Human, C-HA tag HG10095-CY
PXN cDNA ORF Clone, Human, N-HA tag HG10095-NY
PXN cDNA ORF Clone, Human, N-Myc tag HG10095-NM
PXN qPCR Primer Pairs, Human HP100177
info info
添加购物车成功! 添加购物车失败!