After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human IL-8/Interleukin-8/CXCL8 Gene ORF cDNA clone expression plasmid, C-Myc tag

DatasheetReviewsRelated ProductsProtocols
Human CXCL8 cDNA Clone Product Information
NCBI RefSeq:NM_000584.2
RefSeq ORF Size:300bp
cDNA Description:Full length Clone DNA of Homo sapiens interleukin 8 with C terminal Myc tag.
Gene Synonym:CXCL8, GCP-1, GCP1, LECT, LUCT, LYNAP, MDNCF, MONAP, NAF, NAP-1, NAP1
Species:Human
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Interleukin 8 (IL-8), also known as CXCL8, which is a chemokine with a defining CXC amino acid motif that was initially characterized for its leukocyte chemotactic activity, is now known to possess tumorigenic and proangiogenic properties as well. This chemokine is secreted by a variety of cell types including monocyte/macrophages, T cells, neutrophils, fibroblasts, endothelial cells, and various tumor cell lines in response to inflammatory stimuli (IL1, TNF, LPS, etc). In human gliomas, IL-8 is expressed and secreted at high levels both in vitro and in vivo, and recent experiments suggest it is critical to glial tumor neovascularity and progression. Levels of IL-8 correlate with histologic grade in glial neoplasms, and the most malignant form, glioblastoma, shows the highest expression in pseudopalisading cells around necrosis, suggesting that hypoxia/anoxia may stimulate expression. Interleukin (IL)-8/CXCL8 is a potent neutrophil chemotactic factor. Accumulating evidence has demonstrated that various types of cells can produce a large amount of IL-8/CXCL8 in response to a wide variety of stimuli, including proinflammatory cytokines, microbes and their products, and environmental changes such as hypoxia, reperfusion, and hyperoxia. Numerous observations have established IL-8/CXCL8 as a key mediator in neutrophil-mediated acute inflammation due to its potent actions on neutrophils. However, several lines of evidence indicate that IL-8/CXCL8 has a wide range of actions on various types of cells, including lymphocytes, monocytes, endothelial cells, and fibroblasts, besides neutrophils. The discovery of these biological functions suggests that IL-8/CXCL8 has crucial roles in various pathological conditions such as chronic inflammation and cancer. IL-8 has been associated with tumor angiogenesis, metastasis, and poor prognosis in breast cancer. IL-8 may present a novel therapeutic target for estrogen driven breast carcinogenesis and tumor progression.

References
  • Mukaida N. (2003) Pathophysiological roles of interleukin-8/CXCL8 in pulmonary diseases. Am J Physiol Lung Cell Mol Physiol. 284(4): L566-77.
  • Brat DJ, et al. (2005) The role of interleukin-8 and its receptors in gliomagenesis and tumoral angiogenesis. Neuro Oncol. 7(2): 122-33.
  • Bendrik C, et al. (2009) Estradiol increases IL-8 secretion of normal human breast tissue and breast cancer in vivo. J Immunol. 182(1): 371-8.
  • Size / Price
    Catalog: HG10098-CM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"