CHEK1 cDNA ORF Clone, Human, N-HA tag

Cat: HG10539-NY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All CHEK1 Reagents
CRO Services
Product recommended

All CHEK1 Reagents
CHEK1 cDNA ORF Clone, Human, N-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1431 bp
Description
Full length Clone DNA of Human CHK1 checkpoint homolog (S. pombe) with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CHEK1 cDNA ORF Clone, Human, N-HA tag Alternative Names
CHK1 cDNA ORF Clone, Human
CHEK1 Background Information

CHK1 / CHEK1 contains 1 protein kinase domain and belongs to the protein kinase superfamily, CAMK Ser/Thr protein kinase family, NIM1 subfamily. It is a member of checkpoint kinases (Chks). Chks Checkpoint kinases (Chks) are serine/threonine kinases that are involved in the control of the cell cycle. There are two subtypes of chks that have so far been identified, CHK1 / CHEK1 and Chk2. They are essential components to delay cell cycle progression in normal and damaged cells and can act at all three cell cycle checkpoints. Chks are activated by phosphorylation. ATR kinase phosphorylates CHK1 / CHEK1 in response to single strand DNA breaks and ATM kinase phosphorylates Chk2 in response to double strand breaks. Chks phosphorylate Cdc25 phosphatase at Ser216, which leads to Cdc25 sequestration in the cytoplasm. Chks have a role in the physiological stress of hypoxia/reoxygenation. CHK1 / CHEK1 is required for checkpoint mediated cell cycle arrest in response to DNA damage or the presence of unreplicated DNA. CHK1 / CHEK1 may also negatively regulate cell cycle progression during unperturbed cell cycles.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
checkpoint kinase 1
References
  • Chen P, et al. (2000) The 1.7 a crystal structure of human cell cycle checkpoint kinase CHK1 / CHEK1: Implications for CHK1 / CHEK1 regulation. Cell. 100 (6): 681-92.
  • Sanchez Y, et al. (1997) Conservation of the CHK1 / CHEK1 checkpoint pathway in mammals: linkage of DNA damage to Cdk regulation through Cdc25. Science. 277 (5331): 1497-501.
  • Flaggs G, et al. (1998) Atm-dependent interactions of a mammalian CHK1 / CHEK1 homolog with meiotic chromosomes. Curr Biol. 7 (12): 977-86.
  • Chini CC, et al. (2005) Claspin, a regulator of CHK1 / CHEK1 in DNA replication stress pathway. DNA Repair. 3 (8-9): 1033-7.
  • CHEK1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CHEK1 cDNA ORF Clone in Cloning Vector, Mouse MG50248-M
    CHEK1 cDNA ORF Clone, Mouse, untagged MG50248-UT
    CHEK1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50248-ACGLN
    CHEK1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50248-ACG
    CHEK1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50248-ANG
    CHEK1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50248-ACR
    CHEK1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50248-ANR
    CHEK1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50248-CF
    CHEK1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50248-NF
    CHEK1 cDNA ORF Clone, Mouse, C-His tag MG50248-CH
    CHEK1 cDNA ORF Clone, Mouse, N-His tag MG50248-NH
    CHEK1 cDNA ORF Clone, Mouse, C-HA tag MG50248-CY
    CHEK1 cDNA ORF Clone, Mouse, N-HA tag MG50248-NY
    CHEK1 cDNA ORF Clone, Mouse, C-Myc tag MG50248-CM
    CHEK1 cDNA ORF Clone, Mouse, N-Myc tag MG50248-NM
    CHEK1 qPCR Primer Pairs, Mouse MP200274

    CHEK1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CHEK1 cDNA ORF Clone in Cloning Vector, Human HG10539-M
    CHEK1 cDNA ORF Clone, Human, untagged HG10539-UT
    CHEK1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10539-ACGLN
    CHEK1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10539-ACG
    CHEK1 cDNA ORF Clone, Human, N-GFPSpark® tag HG10539-ANG
    CHEK1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10539-ACR
    CHEK1 cDNA ORF Clone, Human, N-OFPSpark® tag HG10539-ANR
    CHEK1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10539-CF
    CHEK1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10539-NF
    CHEK1 cDNA ORF Clone, Human, C-His tag HG10539-CH
    CHEK1 cDNA ORF Clone, Human, N-His tag HG10539-NH
    CHEK1 cDNA ORF Clone, Human, C-HA tag HG10539-CY
    CHEK1 cDNA ORF Clone, Human, C-Myc tag HG10539-CM
    CHEK1 cDNA ORF Clone, Human, N-Myc tag HG10539-NM
    CHEK1 qPCR Primer Pairs, Human HP100555
    info info
    添加购物车成功! 添加购物车失败!