FGF2 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG10014-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All FGF2 Reagents
CRO Services
Product recommended

All FGF2 Reagents
FGF2 cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
RefSeq ORF Size
468 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human fibroblast growth factor 2 (basic) with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Restriction Sites
KpnI + XbaI (6kb + 0.52kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
FGF2 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FGF2 cDNA ORF Clone, Human, N-DDK (Flag®) tag Validated Images
Human bFGF/FGF2 Gene Expression validated Image 1394
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
Human aFGF/FGF1 Gene Plasmid Map 5637
FGF2 cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names
BFGF cDNA ORF Clone, Human;FGF-2 cDNA ORF Clone, Human;FGFB cDNA ORF Clone, Human;HBGF-2 cDNA ORF Clone, Human
FGF2 Background Information

Basic fibroblast growth factor (bFGF), also known as FGF2, is a member of the fibroblast growth factor (FGF) family. It is a highly specific chemotactic and mitogenic factor for many cell types, appears to be involved in remodeling damaged tissue, such as ulcer healing, vascular repair, traumatic brain injury (TBI). bFGF is a critical component of human embryonic stem cell culture medium. In addition, bFGF protein is a heparin-binding cationic protein involved in a variety of pathological conditions including angiogenesis and solid tumour growth. Thus, bFGF is regarded as a target for cancers chemopreventive and therapeutic strategies.

bFGF/FGF2 Protein & Antibody Products

Full Name
fibroblast growth factor 2 (basic)
References
  • Takayama S,et al. (2001) Periodontal regeneration by FGF-2 (bFGF) in primate models. J Dent Res. 80(12): 2075-9.
  • Niu YJ, et al. (2004) Therapeutic effect of bFGF on retina ischemia-reperfusion injury. Chin Med J (Engl). 117(2): 252-7.
  • Zhang Y,et al. (2004) Expression of aFGF, bFGF, and FGFR1 in ovarian epithelial neoplasm. Chin Med J (Engl). 117(4): 601-3.
  • FGF2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    FGF2 cDNA ORF Clone in Cloning Vector, Mouse MG50037-M
    FGF2 cDNA ORF Clone, Mouse, untagged MG50037-UT
    FGF2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50037-ACG
    FGF2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50037-ACGLN
    FGF2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50037-ANG
    FGF2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50037-ACR
    FGF2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50037-CF
    FGF2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50037-NF
    FGF2 cDNA ORF Clone, Mouse, C-His tag MG50037-CH
    FGF2 cDNA ORF Clone, Mouse, N-His tag MG50037-NH
    FGF2 cDNA ORF Clone, Mouse, C-HA tag MG50037-CY
    FGF2 cDNA ORF Clone, Mouse, N-HA tag MG50037-NY
    FGF2 cDNA ORF Clone, Mouse, C-Myc tag MG50037-CM
    FGF2 cDNA ORF Clone, Mouse, N-Myc tag MG50037-NM
    FGF2 qPCR Primer Pairs, Mouse MP200037

    FGF2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    FGF2 cDNA ORF Clone in Cloning Vector, Human HG10014-M
    FGF2 cDNA ORF Clone, Human, untagged HG10014-UT
    FGF2 cDNA ORF Clone, Human, C-GFPSpark® tag HG10014-ACG
    FGF2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10014-ACGLN
    FGF2 cDNA ORF Clone, Human, N-GFPSpark® tag HG10014-ANG
    FGF2 cDNA ORF Clone, Human, C-OFPSpark® tag HG10014-ACR
    FGF2 cDNA ORF Clone, Human, N-OFPSpark® tag HG10014-ANR
    FGF2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10014-CF
    FGF2 cDNA ORF Clone, Human, C-His tag HG10014-CH
    FGF2 cDNA ORF Clone, Human, N-His tag HG10014-NH
    FGF2 cDNA ORF Clone, Human, C-HA tag HG10014-CY
    FGF2 cDNA ORF Clone, Human, N-HA tag HG10014-NY
    FGF2 cDNA ORF Clone, Human, C-Myc tag HG10014-CM
    FGF2 cDNA ORF Clone, Human, N-Myc tag HG10014-NM
    FGF2 qPCR Primer Pairs, Human HP100111
    info info
    添加购物车成功! 添加购物车失败!