ZNHIT3 cDNA ORF Clone, Human, C-His tag

Cat: HG16458-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ZNHIT3 Reagents
CRO Services
Product recommended

All ZNHIT3 Reagents
ZNHIT3 cDNA ORF Clone, Human, C-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
468 bp
Description
Full length Clone DNA of Human zinc finger, HIT-type containing 3 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ZNHIT3 cDNA ORF Clone, Human, C-His tag Alternative Names
TRIP3 cDNA ORF Clone, Human
ZNHIT3 Background Information
Full Name
zinc finger, HIT-type containing 3

ZNHIT3 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
ZNHIT3 cDNA ORF Clone in Cloning Vector, Rat RG8A5672-U
ZNHIT3 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A5672-ACGLN

ZNHIT3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ZNHIT3 cDNA ORF Clone in Cloning Vector, Mouse MG53798-U
ZNHIT3 cDNA ORF Clone, Mouse, untagged MG53798-UT
ZNHIT3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53798-ACG
ZNHIT3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53798-ACGLN
ZNHIT3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53798-ANG
ZNHIT3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53798-ACR
ZNHIT3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53798-ANR
ZNHIT3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53798-CF
ZNHIT3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53798-NF
ZNHIT3 cDNA ORF Clone, Mouse, C-His tag MG53798-CH
ZNHIT3 cDNA ORF Clone, Mouse, N-His tag MG53798-NH
ZNHIT3 cDNA ORF Clone, Mouse, C-HA tag MG53798-CY
ZNHIT3 cDNA ORF Clone, Mouse, N-HA tag MG53798-NY
ZNHIT3 cDNA ORF Clone, Mouse, C-Myc tag MG53798-CM
ZNHIT3 cDNA ORF Clone, Mouse, N-Myc tag MG53798-NM

ZNHIT3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ZNHIT3 cDNA ORF Clone in Cloning Vector, Human HG16458-G
ZNHIT3 cDNA ORF Clone, Human, untagged HG16458-UT
ZNHIT3 cDNA ORF Clone, Human, C-GFPSpark® tag HG16458-ACG
ZNHIT3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16458-ACGLN
ZNHIT3 cDNA ORF Clone, Human, N-GFPSpark® tag HG16458-ANG
ZNHIT3 cDNA ORF Clone, Human, C-OFPSpark® tag HG16458-ACR
ZNHIT3 cDNA ORF Clone, Human, N-OFPSpark® tag HG16458-ANR
ZNHIT3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16458-CF
ZNHIT3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16458-NF
ZNHIT3 cDNA ORF Clone, Human, N-His tag HG16458-NH
ZNHIT3 cDNA ORF Clone, Human, C-HA tag HG16458-CY
ZNHIT3 cDNA ORF Clone, Human, N-HA tag HG16458-NY
ZNHIT3 cDNA ORF Clone, Human, C-Myc tag HG16458-CM
ZNHIT3 cDNA ORF Clone, Human, N-Myc tag HG16458-NM
ZNHIT3 qPCR Primer Pairs, Human HP105204
info info
添加购物车成功! 添加购物车失败!