ZG16 cDNA ORF Clone, Human, C-HA tag

Cat: HG13450-CY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All ZG16 Reagents
CRO Services
Product recommended

All ZG16 Reagents
ZG16 cDNA ORF Clone, Human, C-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
504 bp
Description
Full length Clone DNA of Human zymogen granule protein 16 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ZG16 cDNA ORF Clone, Human, C-HA tag Alternative Names
JCLN cDNA ORF Clone, Human;JCLN1 cDNA ORF Clone, Human;ZG16A cDNA ORF Clone, Human
ZG16 Background Information
Full Name
zymogen granule protein 16

ZG16 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
ZG16 cDNA ORF Clone in Cloning Vector, Rhesus CG90528-U
ZG16 cDNA ORF Clone, Rhesus, untagged CG90528-UT
ZG16 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90528-ACG
ZG16 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90528-ACGLN
ZG16 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90528-ACR
ZG16 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90528-CF
ZG16 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90528-NF
ZG16 cDNA ORF Clone, Rhesus, C-His tag CG90528-CH
ZG16 cDNA ORF Clone, Rhesus, N-His tag CG90528-NH
ZG16 cDNA ORF Clone, Rhesus, C-HA tag CG90528-CY
ZG16 cDNA ORF Clone, Rhesus, N-HA tag CG90528-NY
ZG16 cDNA ORF Clone, Rhesus, C-Myc tag CG90528-CM
ZG16 cDNA ORF Clone, Rhesus, N-Myc tag CG90528-NM

ZG16 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ZG16 cDNA ORF Clone in Cloning Vector, Mouse MG5A6875-U
ZG16 cDNA ORF Clone, Mouse, untagged MG5A6875-UT
ZG16 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A6875-ACGLN
ZG16 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A6875-ACG
ZG16 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A6875-ACR
ZG16 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A6875-CF
ZG16 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A6875-NF
ZG16 cDNA ORF Clone, Mouse, C-His tag MG5A6875-CH
ZG16 cDNA ORF Clone, Mouse, N-His tag MG5A6875-NH
ZG16 cDNA ORF Clone, Mouse, C-HA tag MG5A6875-CY
ZG16 cDNA ORF Clone, Mouse, N-HA tag MG5A6875-NY
ZG16 cDNA ORF Clone, Mouse, C-Myc tag MG5A6875-CM
ZG16 cDNA ORF Clone, Mouse, N-Myc tag MG5A6875-NM

ZG16 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ZG16 cDNA ORF Clone in Cloning Vector, Human HG13450-G
ZG16 cDNA ORF Clone, Human, untagged HG13450-UT
ZG16 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13450-ACGLN
ZG16 cDNA ORF Clone, Human, C-GFPSpark® tag HG13450-ACG
ZG16 cDNA ORF Clone, Human, C-OFPSpark® tag HG13450-ACR
ZG16 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13450-CF
ZG16 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13450-NF
ZG16 cDNA ORF Clone, Human, C-His tag HG13450-CH
ZG16 cDNA ORF Clone, Human, N-His tag HG13450-NH
ZG16 cDNA ORF Clone, Human, N-HA tag HG13450-NY
ZG16 cDNA ORF Clone, Human, C-Myc tag HG13450-CM
ZG16 cDNA ORF Clone, Human, N-Myc tag HG13450-NM
ZG16 qPCR Primer Pairs, Human HP102150
info info
添加购物车成功! 添加购物车失败!