ZDHHC4 cDNA ORF Clone, Human, untagged

Cat: HG16190-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ZDHHC4 Reagents
CRO Services
Product recommended

All ZDHHC4 Reagents
ZDHHC4 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1035 bp
Description
Full length Clone DNA of Human zinc finger, DHHC-type containing 4.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ZDHHC4 cDNA ORF Clone, Human, untagged Alternative Names
ZNF374 cDNA ORF Clone, Human
ZDHHC4 Background Information
Full Name
zinc finger, DHHC-type containing 4

ZDHHC4 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
ZDHHC4 cDNA ORF Clone in Cloning Vector, Rat RG81439-G

ZDHHC4 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ZDHHC4 cDNA ORF Clone in Cloning Vector, Mouse MG5A6328-U
ZDHHC4 cDNA ORF Clone, Mouse, untagged MG5A6328-UT
ZDHHC4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A6328-ACGLN
ZDHHC4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A6328-ACG
ZDHHC4 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A6328-ANG
ZDHHC4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A6328-ACR
ZDHHC4 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A6328-ANR
ZDHHC4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A6328-CF
ZDHHC4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A6328-NF
ZDHHC4 cDNA ORF Clone, Mouse, C-His tag MG5A6328-CH
ZDHHC4 cDNA ORF Clone, Mouse, N-His tag MG5A6328-NH
ZDHHC4 cDNA ORF Clone, Mouse, C-HA tag MG5A6328-CY
ZDHHC4 cDNA ORF Clone, Mouse, N-HA tag MG5A6328-NY
ZDHHC4 cDNA ORF Clone, Mouse, C-Myc tag MG5A6328-CM
ZDHHC4 cDNA ORF Clone, Mouse, N-Myc tag MG5A6328-NM

ZDHHC4 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ZDHHC4 cDNA ORF Clone in Cloning Vector, Human HG16190-G
ZDHHC4 cDNA ORF Clone, Human, C-GFPSpark® tag HG16190-ACG
ZDHHC4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16190-ACGLN
ZDHHC4 cDNA ORF Clone, Human, C-OFPSpark® tag HG16190-ACR
ZDHHC4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16190-CF
ZDHHC4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16190-NF
ZDHHC4 cDNA ORF Clone, Human, C-His tag HG16190-CH
ZDHHC4 cDNA ORF Clone, Human, N-His tag HG16190-NH
ZDHHC4 cDNA ORF Clone, Human, C-HA tag HG16190-CY
ZDHHC4 cDNA ORF Clone, Human, N-HA tag HG16190-NY
ZDHHC4 cDNA ORF Clone, Human, C-Myc tag HG16190-CM
ZDHHC4 cDNA ORF Clone, Human, N-Myc tag HG16190-NM
ZDHHC4 qPCR Primer Pairs, Human HP104958
info info
添加购物车成功! 添加购物车失败!