14-3-3 gamma/YWHAG cDNA ORF Clone, Human, N-Myc tag

Cat: HG10846-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All 14-3-3 gamma/YWHAG Reagents
CRO Services
Product recommended

All 14-3-3 gamma/YWHAG Reagents
14-3-3 gamma/YWHAG cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
744 bp
Description
Full length Clone DNA of Human tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma polypeptide with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

14-3-3 gamma/YWHAG cDNA ORF Clone, Human, N-Myc tag Alternative Names
14-3-3GAMMA cDNA ORF Clone, Human;PPP1R170 cDNA ORF Clone, Human
14-3-3 gamma/YWHAG Background Information
Full Name
tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma

14-3-3 gamma/YWHAG cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
14-3-3 gamma/YWHAG cDNA ORF Clone in Cloning Vector, Rat RG81384-G

14-3-3 gamma/YWHAG cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
14-3-3 gamma/YWHAG cDNA ORF Clone in Cloning Vector, Mouse MG50863-G
14-3-3 gamma/YWHAG cDNA ORF Clone, Mouse, untagged MG50863-UT
14-3-3 gamma/YWHAG cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50863-ACG
14-3-3 gamma/YWHAG Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50863-ACGLN
14-3-3 gamma/YWHAG cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50863-ANG
14-3-3 gamma/YWHAG cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50863-ACR
14-3-3 gamma/YWHAG cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50863-ANR
14-3-3 gamma/YWHAG cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50863-CF
14-3-3 gamma/YWHAG cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50863-NF
14-3-3 gamma/YWHAG cDNA ORF Clone, Mouse, C-His tag MG50863-CH
14-3-3 gamma/YWHAG cDNA ORF Clone, Mouse, N-His tag MG50863-NH
14-3-3 gamma/YWHAG cDNA ORF Clone, Mouse, C-HA tag MG50863-CY
14-3-3 gamma/YWHAG cDNA ORF Clone, Mouse, N-HA tag MG50863-NY
14-3-3 gamma/YWHAG cDNA ORF Clone, Mouse, C-Myc tag MG50863-CM
14-3-3 gamma/YWHAG cDNA ORF Clone, Mouse, N-Myc tag MG50863-NM
14-3-3 gamma/YWHAG qPCR Primer Pairs, Mouse MP200834

14-3-3 gamma/YWHAG cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
14-3-3 gamma/YWHAG cDNA ORF Clone in Cloning Vector, Human HG10846-M
14-3-3 gamma/YWHAG cDNA ORF Clone, Human, untagged HG10846-UT
14-3-3 gamma/YWHAG Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10846-ACGLN
14-3-3 gamma/YWHAG cDNA ORF Clone, Human, C-GFPSpark® tag HG10846-ACG
14-3-3 gamma/YWHAG cDNA ORF Clone, Human, N-GFPSpark® tag HG10846-ANG
14-3-3 gamma/YWHAG cDNA ORF Clone, Human, C-OFPSpark® tag HG10846-ACR
14-3-3 gamma/YWHAG cDNA ORF Clone, Human, N-OFPSpark® tag HG10846-ANR
14-3-3 gamma/YWHAG cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10846-CF
14-3-3 gamma/YWHAG cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10846-NF
14-3-3 gamma/YWHAG cDNA ORF Clone, Human, C-His tag HG10846-CH
14-3-3 gamma/YWHAG cDNA ORF Clone, Human, N-His tag HG10846-NH
14-3-3 gamma/YWHAG cDNA ORF Clone, Human, C-HA tag HG10846-CY
14-3-3 gamma/YWHAG cDNA ORF Clone, Human, N-HA tag HG10846-NY
14-3-3 gamma/YWHAG cDNA ORF Clone, Human, C-Myc tag HG10846-CM
14-3-3 gamma/YWHAG qPCR Primer Pairs, Human HP100743
info info
添加购物车成功! 添加购物车失败!