YKT6 cDNA ORF Clone, Human, C-Myc tag

Cat: HG15666-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All YKT6 Reagents
CRO Services
Product recommended

All YKT6 Reagents
YKT6 cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
597 bp
Description
Full length Clone DNA of Human YKT6 v-SNARE homolog (S. cerevisiae) with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

YKT6 Background Information
Full Name
YKT6 v-SNARE homolog (S. cerevisiae)

YKT6 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
YKT6 cDNA ORF Clone in Cloning Vector, Mouse MG52437-G
YKT6 cDNA ORF Clone, Mouse, untagged MG52437-UT
YKT6 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52437-ACG
YKT6 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52437-ACGLN
YKT6 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52437-ANG
YKT6 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52437-ACR
YKT6 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52437-ANR
YKT6 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52437-CF
YKT6 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52437-NF
YKT6 cDNA ORF Clone, Mouse, C-His tag MG52437-CH
YKT6 cDNA ORF Clone, Mouse, N-His tag MG52437-NH
YKT6 cDNA ORF Clone, Mouse, C-HA tag MG52437-CY
YKT6 cDNA ORF Clone, Mouse, N-HA tag MG52437-NY
YKT6 cDNA ORF Clone, Mouse, C-Myc tag MG52437-CM
YKT6 cDNA ORF Clone, Mouse, N-Myc tag MG52437-NM
YKT6 qPCR Primer Pairs, Mouse MP202310

YKT6 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
YKT6 cDNA ORF Clone in Cloning Vector, Human HG15666-G
YKT6 cDNA ORF Clone, Human, untagged HG15666-UT
YKT6 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15666-ACGLN
YKT6 cDNA ORF Clone, Human, C-GFPSpark® tag HG15666-ACG
YKT6 cDNA ORF Clone, Human, N-GFPSpark® tag HG15666-ANG
YKT6 cDNA ORF Clone, Human, C-OFPSpark® tag HG15666-ACR
YKT6 cDNA ORF Clone, Human, N-OFPSpark® tag HG15666-ANR
YKT6 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15666-CF
YKT6 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15666-NF
YKT6 cDNA ORF Clone, Human, C-His tag HG15666-CH
YKT6 cDNA ORF Clone, Human, N-His tag HG15666-NH
YKT6 cDNA ORF Clone, Human, C-HA tag HG15666-CY
YKT6 cDNA ORF Clone, Human, N-HA tag HG15666-NY
YKT6 cDNA ORF Clone, Human, N-Myc tag HG15666-NM
YKT6 qPCR Primer Pairs, Human HP104281
info info
添加购物车成功! 添加购物车失败!