YIPF6 cDNA ORF Clone, Human, untagged

Cat: HG16295-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All YIPF6 Reagents
CRO Services
Product recommended

All YIPF6 Reagents
YIPF6 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
711 bp
Description
Full length Clone DNA of Human Yip1 domain family, member 6.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

YIPF6 cDNA ORF Clone, Human, untagged Alternative Names
FinGER6 cDNA ORF Clone, Human
YIPF6 Background Information
Full Name
Yip1 domain family, member 6

YIPF6 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
YIPF6 cDNA ORF Clone in Cloning Vector, Rat RG89834-U
YIPF6 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG89834-ACGLN

YIPF6 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
YIPF6 cDNA ORF Clone in Cloning Vector, Mouse MG52644-U
YIPF6 cDNA ORF Clone, Mouse, untagged MG52644-UT
YIPF6 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52644-ACG
YIPF6 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52644-ACGLN
YIPF6 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52644-ANG
YIPF6 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52644-ACR
YIPF6 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52644-ANR
YIPF6 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52644-CF
YIPF6 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52644-NF
YIPF6 cDNA ORF Clone, Mouse, C-His tag MG52644-CH
YIPF6 cDNA ORF Clone, Mouse, N-His tag MG52644-NH
YIPF6 cDNA ORF Clone, Mouse, C-HA tag MG52644-CY
YIPF6 cDNA ORF Clone, Mouse, N-HA tag MG52644-NY
YIPF6 cDNA ORF Clone, Mouse, C-Myc tag MG52644-CM
YIPF6 cDNA ORF Clone, Mouse, N-Myc tag MG52644-NM
YIPF6 qPCR Primer Pairs, Mouse MP202515

YIPF6 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
YIPF6 cDNA ORF Clone in Cloning Vector, Human HG16295-G
YIPF6 cDNA ORF Clone, Human, C-GFPSpark® tag HG16295-ACG
YIPF6 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16295-ACGLN
YIPF6 cDNA ORF Clone, Human, C-OFPSpark® tag HG16295-ACR
YIPF6 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16295-CF
YIPF6 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16295-NF
YIPF6 cDNA ORF Clone, Human, C-His tag HG16295-CH
YIPF6 cDNA ORF Clone, Human, N-His tag HG16295-NH
YIPF6 cDNA ORF Clone, Human, C-HA tag HG16295-CY
YIPF6 cDNA ORF Clone, Human, N-HA tag HG16295-NY
YIPF6 cDNA ORF Clone, Human, C-Myc tag HG16295-CM
YIPF6 cDNA ORF Clone, Human, N-Myc tag HG16295-NM
YIPF6 qPCR Primer Pairs, Human HP105049
info info
添加购物车成功! 添加购物车失败!