Quick Order

Human YIF1B ORF mammalian expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Human YIF1B cDNA Clone Product Information
NCBI RefSeq:BC014974
RefSeq ORF Size:885bp
cDNA Description:Full length Clone DNA of Homo sapiens Yip1 interacting factor homolog B (S. cerevisiae) with N terminal His tag.
Gene Synonym:hCG_1785221, FLJ23477, FLJ50074, FinGER8, MGC39135, YIF1B
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Size / Price
Catalog: HG14396-NH
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeks
 Shipping instructions
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"