YARS2 cDNA ORF Clone, Human, C-Myc tag

Cat: HG14832-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All YARS2 Reagents
CRO Services
Product recommended

All YARS2 Reagents
YARS2 cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1434 bp
Description
Full length Clone DNA of Human tyrosyl-tRNA synthetase 2, mitochondrial with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

YARS2 cDNA ORF Clone, Human, C-Myc tag Alternative Names
CGI-04 cDNA ORF Clone, Human;MLASA2 cDNA ORF Clone, Human;MT-TYRRS cDNA ORF Clone, Human;TYRRS cDNA ORF Clone, Human
YARS2 Background Information
Full Name
tyrosyl-tRNA synthetase 2, mitochondrial

YARS2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
YARS2 cDNA ORF Clone in Cloning Vector, Mouse MG52699-G
YARS2 cDNA ORF Clone, Mouse, untagged MG52699-UT
YARS2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52699-ACG
YARS2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52699-ACGLN
YARS2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52699-ANG
YARS2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52699-ACR
YARS2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52699-ANR
YARS2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52699-CF
YARS2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52699-NF
YARS2 cDNA ORF Clone, Mouse, C-His tag MG52699-CH
YARS2 cDNA ORF Clone, Mouse, N-His tag MG52699-NH
YARS2 cDNA ORF Clone, Mouse, C-HA tag MG52699-CY
YARS2 cDNA ORF Clone, Mouse, N-HA tag MG52699-NY
YARS2 cDNA ORF Clone, Mouse, C-Myc tag MG52699-CM
YARS2 cDNA ORF Clone, Mouse, N-Myc tag MG52699-NM
YARS2 qPCR Primer Pairs, Mouse MP202570

YARS2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
YARS2 cDNA ORF Clone in Cloning Vector, Human HG14832-G
YARS2 cDNA ORF Clone, Human, untagged HG14832-UT
YARS2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14832-ACGLN
YARS2 cDNA ORF Clone, Human, C-GFPSpark® tag HG14832-ACG
YARS2 cDNA ORF Clone, Human, N-GFPSpark® tag HG14832-ANG
YARS2 cDNA ORF Clone, Human, C-OFPSpark® tag HG14832-ACR
YARS2 cDNA ORF Clone, Human, N-OFPSpark® tag HG14832-ANR
YARS2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14832-CF
YARS2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14832-NF
YARS2 cDNA ORF Clone, Human, C-His tag HG14832-CH
YARS2 cDNA ORF Clone, Human, N-His tag HG14832-NH
YARS2 cDNA ORF Clone, Human, C-HA tag HG14832-CY
YARS2 cDNA ORF Clone, Human, N-HA tag HG14832-NY
YARS2 cDNA ORF Clone, Human, N-Myc tag HG14832-NM
YARS2 qPCR Primer Pairs, Human HP103463
info info
添加购物车成功! 添加购物车失败!