XPR1 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG15194-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All XPR1 Reagents
CRO Services
Product recommended

All XPR1 Reagents
XPR1 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1896 bp
Description
Full length Clone DNA of Human xenotropic and polytropic retrovirus receptor 1 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

XPR1 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
SYG1 cDNA ORF Clone, Human;X3 cDNA ORF Clone, Human
XPR1 Background Information
Full Name
xenotropic and polytropic retrovirus receptor 1

XPR1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
XPR1 cDNA ORF Clone in Cloning Vector, Mouse MG5A0011-U
XPR1 cDNA ORF Clone, Mouse, untagged MG5A0011-UT
XPR1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A0011-ACG
XPR1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A0011-ACGLN
XPR1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A0011-ANG
XPR1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A0011-ACR
XPR1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A0011-ANR
XPR1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A0011-CF
XPR1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A0011-NF
XPR1 cDNA ORF Clone, Mouse, C-His tag MG5A0011-CH
XPR1 cDNA ORF Clone, Mouse, N-His tag MG5A0011-NH
XPR1 cDNA ORF Clone, Mouse, C-HA tag MG5A0011-CY
XPR1 cDNA ORF Clone, Mouse, N-HA tag MG5A0011-NY
XPR1 cDNA ORF Clone, Mouse, C-Myc tag MG5A0011-CM
XPR1 cDNA ORF Clone, Mouse, N-Myc tag MG5A0011-NM

XPR1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
XPR1 cDNA ORF Clone in Cloning Vector, Human HG15194-G
XPR1 cDNA ORF Clone, Human, untagged HG15194-UT
XPR1 cDNA ORF Clone, Human, C-GFPSpark® tag HG15194-ACG
XPR1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15194-ACGLN
XPR1 cDNA ORF Clone, Human, C-OFPSpark® tag HG15194-ACR
XPR1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15194-NF
XPR1 cDNA ORF Clone, Human, C-His tag HG15194-CH
XPR1 cDNA ORF Clone, Human, N-His tag HG15194-NH
XPR1 cDNA ORF Clone, Human, C-HA tag HG15194-CY
XPR1 cDNA ORF Clone, Human, N-HA tag HG15194-NY
XPR1 cDNA ORF Clone, Human, C-Myc tag HG15194-CM
XPR1 cDNA ORF Clone, Human, N-Myc tag HG15194-NM
XPR1 qPCR Primer Pairs, Human HP103820
info info
添加购物车成功! 添加购物车失败!