XBP1 cDNA ORF Clone, Human, C-Myc tag

Cat: HG10751-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All XBP1 Reagents
CRO Services
Product recommended

All XBP1 Reagents
XBP1 cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
786 bp
Description
Full length Clone DNA of Human X-box binding protein 1 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

XBP1 cDNA ORF Clone, Human, C-Myc tag Alternative Names
TREB-5 cDNA ORF Clone, Human;TREB5 cDNA ORF Clone, Human;XBP-1 cDNA ORF Clone, Human;XBP2 cDNA ORF Clone, Human
XBP1 Background Information
Full Name
X-box binding protein 1

XBP1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
XBP1 cDNA ORF Clone in Cloning Vector, Rat RG82638-U
XBP1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG82638-ACGLN

XBP1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
XBP1 cDNA ORF Clone in Cloning Vector, Mouse MG51037-G
XBP1 cDNA ORF Clone, Mouse, untagged MG51037-UT
XBP1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51037-ACGLN
XBP1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51037-ACG
XBP1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51037-ANG
XBP1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51037-ACR
XBP1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51037-ANR
XBP1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51037-CF
XBP1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51037-NF
XBP1 cDNA ORF Clone, Mouse, C-His tag MG51037-CH
XBP1 cDNA ORF Clone, Mouse, N-His tag MG51037-NH
XBP1 cDNA ORF Clone, Mouse, C-HA tag MG51037-CY
XBP1 cDNA ORF Clone, Mouse, N-HA tag MG51037-NY
XBP1 cDNA ORF Clone, Mouse, C-Myc tag MG51037-CM
XBP1 cDNA ORF Clone, Mouse, N-Myc tag MG51037-NM
XBP1 qPCR Primer Pairs, Mouse MP200996

XBP1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
XBP1 cDNA ORF Clone in Cloning Vector, Human HG10751-M
XBP1 cDNA ORF Clone, Human, untagged HG10751-UT
XBP1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10751-ACG
XBP1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10751-ACGLN
XBP1 cDNA ORF Clone, Human, N-GFPSpark® tag HG10751-ANG
XBP1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10751-ACR
XBP1 cDNA ORF Clone, Human, N-OFPSpark® tag HG10751-ANR
XBP1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10751-CF
XBP1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10751-NF
XBP1 cDNA ORF Clone, Human, C-His tag HG10751-CH
XBP1 cDNA ORF Clone, Human, N-His tag HG10751-NH
XBP1 cDNA ORF Clone, Human, C-HA tag HG10751-CY
XBP1 cDNA ORF Clone, Human, N-HA tag HG10751-NY
XBP1 cDNA ORF Clone, Human, N-Myc tag HG10751-NM
XBP1 qPCR Primer Pairs, Human HP100896
info info
添加购物车成功! 添加购物车失败!