Quick Order

Human XBP1 Gene ORF cDNA clone expression plasmid

  • Human XBP1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
DatasheetReviewsRelated ProductsProtocols
Human XBP1 cDNA Clone Product Information
NCBI RefSeq:NM_005080.3
RefSeq ORF Size:786bp
cDNA Description:Full length Clone DNA of Homo sapiens X-box binding protein 1.
Gene Synonym:XBP2, TREB5, XBP1
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-XBP1
Restriction Site:HindIII + XbaI (6.1kb + 0.79kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with XBP1 qPCR primers for gene expression analysis, HP100896 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human XBP1 Gene Plasmid Map
Human XBP1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Size / Price
Catalog: HG10751-UT
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
Availability
Add to CartBulk Discount Inquiry

Datasheet & Documentation

Contact Us
    Recently Viewed Items
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"