Quick Order

Text Size:AAA

Human WWP2 Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Human WWP2 cDNA Clone Product Information
NCBI RefSeq:BC064531.1
RefSeq ORF Size:2613bp
cDNA Description:Full length Clone DNA of Homo sapiens WW domain containing E3 ubiquitin protein ligase 2 with N terminal His tag.
Gene Synonym:AIP2, WWp2-like, WWP2
Species:Human
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

WWP2 contains 1 C2 domain, 1 HECT (E6AP-type E3 ubiquitin-protein ligase) domain and 4 WW domains. It is an E3 ubiquitin-protein ligase which accepts ubiquitin from an E2 ubiquitin-conjugating enzyme in the form of a thioester and then directly transfers the ubiquitin to targeted substrates. WWP2 can be detected in heart, throughout the brain, placenta, lung, liver, muscle, kidney and pancreas. It is also expressed in spleen and peripheral blood leukocytes. WWP2 polyubiquitinates POU5F1 by 'Lys-63'-linked conjugation and promotes it to proteasomal degradation; in embryonic stem cells (ESCs) the ubiquitination is proposed to regulate POU5F1 protein level. WWP2 ubiquitinates EGR2 and promotes it to proteasomal degradation; in T-cells the ubiquitination inhibits activation-induced cell death. It also ubiquitinates SLC11A2; the ubiquitination is enhanced by presence of NDFIP1 and NDFIP2. WWP2 ubiquitinates RPB1 and promotes it to proteasomal degradation.

References
  • McDonald FJ, et al. (2002) Ubiquitin-protein ligase WWP2 binds to and downregulates the epithelial Na(+) channel. Am J Physiol Renal Physiol. 283 (3): F431-6.
  • Soond SM, et al. (2011) Selective targeting of activating and inhibitory Smads by distinct WWP2 ubiquitin ligase isoforms differentially modulates TGFβ signalling and EMT. Oncogene. 30 (21): 2451-62.
  • Marcucci R, et al. (2011) Pin1 and WWP2 regulate GluR2 Q/R site RNA editing by ADAR2 with opposing effects. EMBO J. 30 (20): 4211-22.
  • Maddika S, et al. (2011) WWP2 is an E3 ubiquitin ligase for PTEN. Nat Cell Biol. 13 (6): 728-33.
  • Xu H, et al. (2009) WWP2 promotes degradation of transcription factor OCT4 in human embryonic stem cells. Cell Res. 19 (5): 561-73.
  • Size / Price
    Catalog: HG13125-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"