GASP-1 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG11998-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All GASP-1 Reagents
CRO Services
Product recommended

All GASP-1 Reagents
GASP-1 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1731 bp
Description
Full length Clone DNA of Human WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 2 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GASP-1 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
GASP-1 cDNA ORF Clone, Human;hGASP-1 cDNA ORF Clone, Human;WFDC20B cDNA ORF Clone, Human;WFIKKNRP cDNA ORF Clone, Human
GASP-1 Background Information

WAP, kazal, immunoglobulin, kunitz and NTR domain-containing protein 2, also known as Growth and differentiation factor-associated serum protein 1, WAP, follistatin, immunoglobulin, kunitz and NTR domain-containing-related protein, WFIKKN-related protein, WFIKKN2 and GASP1, is a secreted protein which belongs to the WFIKKN family. WFIKKN2 contains two BPTI/Kunitz inhibitor domains, one Ig-like C2-type (immunoglobulin-like) domain, one Kazal-like domain, one NTR domain and one WAP domain. WFIKKN2 is primarily expressed in ovary, testis and brain, but not in liver. In fetal tissues, it is primarily expressed in brain, skeletal muscle, thymus and kidney. WFIKKN2 is protease-inhibitor that contains multiple distinct protease inhibitor domains. It probably has serine protease- and metalloprotease-inhibitor activity. It inhibits the biological activity of mature myostatin, but not activin. WFIKKN2 protein binds mature GDF8/myostatin and myostatin propeptide and inhibits the biological activity of myostatin.

Full Name
WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 2
References
  • Clark H.F.et al., 2003,Genome Res. 13:2265-70.
  • Hill J.J.et al., 2003, Mol. Endocrinol. 17:1144-54.
  • Kondás,K. et al., 2008, J Biol Chem  283 (35):23677-84.
  • info info
    添加购物车成功! 添加购物车失败!