WARS cDNA ORF Clone, Human, C-Myc tag

Cat: HG14827-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All WARS Reagents
CRO Services
Product recommended

All WARS Reagents
WARS cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1416 bp
Description
Full length Clone DNA of Human tryptophanyl-tRNA synthetase with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

WARS cDNA ORF Clone, Human, C-Myc tag Alternative Names
GAMMA-2 cDNA ORF Clone, Human;IFI53 cDNA ORF Clone, Human;IFP53 cDNA ORF Clone, Human
WARS Background Information

WARS, also known as TrpRS, is an aminoacyl-tRNA synthetase which belongs to the class-I aminoacyl-tRNA synthetase family. There are two forms of tryptophanyl-tRNA synthetase: a cytoplasmic form, named WARS, and a mitochondrial form, named WARS2. They catalyze the aminoacylation of tRNA by their cognate amino acid. Because of their central role in linking amino acids with nucleotide triplets contained in tRNAs, aminoacyl-tRNA synthetases are thought to be among the first proteins that appeared in evolution. WARS catalyzes the aminoacylation of tRNA(trp) with tryptophan and is induced by interferon.

Full Name
tryptophanyl-tRNA synthetase
References
  • Buwitt U. et al., 1992, EMBO J. 11 (2): 489-96.
  • Fleckner J. et al., 1992, Proc Natl Acad Sci. 88 (24): 11520-4.
  • Ewalt KL. et al., 2002, Biochemistry. 41 (45): 13344-9.
  • WARS cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    WARS cDNA ORF Clone in Cloning Vector, Mouse MG51542-G
    WARS cDNA ORF Clone, Mouse, untagged MG51542-UT
    WARS Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51542-ACGLN
    WARS cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51542-ACG
    WARS cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51542-ANG
    WARS cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51542-ACR
    WARS cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51542-ANR
    WARS cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51542-CF
    WARS cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51542-NF
    WARS cDNA ORF Clone, Mouse, C-His tag MG51542-CH
    WARS cDNA ORF Clone, Mouse, N-His tag MG51542-NH
    WARS cDNA ORF Clone, Mouse, C-HA tag MG51542-CY
    WARS cDNA ORF Clone, Mouse, N-HA tag MG51542-NY
    WARS cDNA ORF Clone, Mouse, C-Myc tag MG51542-CM
    WARS cDNA ORF Clone, Mouse, N-Myc tag MG51542-NM
    WARS qPCR Primer Pairs, Mouse MP201426

    WARS cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    WARS cDNA ORF Clone in Cloning Vector, Human HG14827-G
    WARS cDNA ORF Clone, Human, untagged HG14827-UT
    WARS cDNA ORF Clone, Human, C-GFPSpark® tag HG14827-ACG
    WARS Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14827-ACGLN
    WARS cDNA ORF Clone, Human, N-GFPSpark® tag HG14827-ANG
    WARS cDNA ORF Clone, Human, C-OFPSpark® tag HG14827-ACR
    WARS cDNA ORF Clone, Human, N-OFPSpark® tag HG14827-ANR
    WARS cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14827-CF
    WARS cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14827-NF
    WARS cDNA ORF Clone, Human, C-His tag HG14827-CH
    WARS cDNA ORF Clone, Human, N-His tag HG14827-NH
    WARS cDNA ORF Clone, Human, C-HA tag HG14827-CY
    WARS cDNA ORF Clone, Human, N-HA tag HG14827-NY
    WARS cDNA ORF Clone, Human, N-Myc tag HG14827-NM
    WARS qPCR Primer Pairs, Human HP103458
    info info
    添加购物车成功! 添加购物车失败!