Quick Order

Human B7-H4/Vtcn1/B7S1 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human VTCN1 cDNA Clone Product Information
NCBI RefSeq:NM_024626.2
RefSeq ORF Size:849bp
cDNA Description:Full length Clone DNA of Homo sapiens V-set domain containing T cell activation inhibitor 1.
Gene Synonym:B7X, B7H4, B7S1, B7-H4, B7h.5, VCTN1, PRO1291, FLJ22418, RP11-229A19.4, VTCN1
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

V-set domain-containing T-cell activation inhibitor 1, also known as B7X, B7H4, B7S1, and VTCN1, is a single-pass type? membrane protein belonging to the B7 family of costimulatory proteins. These proteins are expressed on the surface of antigen-presenting cells and interact with ligands on T lymphocytes. They provide costimulatory signals that regulate T cell responses. A soluble form of B7H4 has also been detected. B7X / VTCN1 / B7H4 negatively regulates T-cell-mediated immune response by inhibiting T-cell activation, proliferation, cytokine production and development of cytotoxicity. When expressed on the cell surface of tumor macrophages, B7X / VTCN1 / B7H4 plays an important role, together with regulatory T-cells(Treg), in the suppression of tumor-associated antigen-specific T-cell immunity. B7X / VTCN1 / B7H4 is also involved in promoting epithelial cell transformation. This membrane protein can be up-regulated by IL6 / interleukin-6 and IL10 / interleukin-10 and inhibited by CSF2 / GM-CSF and IL4 / interleukin-4 on antigen-presenting cells.

References
  • Zang X, et al. (2003) B7x: a widely expressed B7 family member that inhibits T cell activation. Proc Natl Acad Sci U S A. 100(18): 10388-92.
  • Suh WK, et al. (2006) Generation and characterization of B7-H4/B7S1/B7x-deficient mice. Mol Cell Biol. 26(17): 6403-11.
  • Zang X, et al. (2007) B7-H3 and B7x are highly expressed in human prostate cancer and associated with disease spread and poor outcome. Proc Natl Acad Sci U S A. 104(49):19458-63.
  • Size / Price
    Catalog: HG10738-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"