Quick Order

Text Size:AAA

Human VSTM1 Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Human VSTM1 cDNA Clone Product Information
NCBI RefSeq:NM_198481.3
RefSeq ORF Size:711bp
cDNA Description:Full length Clone DNA of Homo sapiens V-set and transmembrane domain containing 1 with N terminal His tag.
Gene Synonym:SIRL1, UNQ3033, MGC119160, MGC119161, VSTM1
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

V-set and transmembrane domain containing 1 (VSTM1) is a protein containing the V-set domains. V-set domains are immunoglobulin-like domains resembling the antibody variable region. V-set domains are found in many kinds of protein families, including immunoglobulin light and heavy chains, several T-cells such as CD2, CD4, CD80, and CD86, myelin membrane adhesion molecules, junction adhesion molecules (JAM), tyrosine-protein kinase receptors, and the programmed cell death protein1.

References
  • Satow Y, et al. (1986) Phosphocholine binding immunoglobulin Fab McPC603. An X-ray diffraction study at 2.7 A. J Mol Biol. 190 (4): 593-604.
  • Rees DC, et al. (2009) ABC transporters: the power to change. Cell Biol. 10 (3): 218-227.
  • Size / Price
    Catalog: HG13171-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"