VSIG4 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG12163-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All VSIG4 Reagents
CRO Services
Product recommended

All VSIG4 Reagents
VSIG4 cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1230 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human V-set and immunoglobulin domain containing 4 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-FLAG
Restriction Sites
KpnI + XbaI(6kb+1.23kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
VSIG4 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

VSIG4 cDNA ORF Clone, Human, N-DDK (Flag®) tag Validated Images
Rhesus CD64/Fc gamma RI Gene Plasmid Map 5614
VSIG4 cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names
CRIg cDNA ORF Clone, Human;Z39IG cDNA ORF Clone, Human
VSIG4 Background Information

VSIG4 (V-set and immunoglobulin domain containing 4), also known as complement receptor of the immunoglobulin superfamily (CRIg) and Z39Ig, is a type I  transmembrane glycoprotein. It is a B7 family-related protein and an Ig superfamily member. In contrast to the B7 family members which contain two IgG domains, VSIG4 contains one complete V-type I g domain and a truncated C-type I g domain. VSIG4 is exclusively expressed on tissue resident macrophages and binds to multimers of C3b and iC3b that are covalently attached to particle surfaces. No VSIG4 expression appears to be present in T and B cells. VSIG4 functions as a negative regulator of T cell activation, and may be involved in the maintenance of peripheral T cell tolerance, and is also identified as a potent suppressor of established inflammation. Mouse VSIG4 is synthesized as a 280 amino acid precursor that contains a signal sequence, an V-type I g domain (aa 36-115), one potential N-linked glycosylation site, and a single transmembrane domain. The V-type I g domain of mouse VSIG4 shares 86% and 80% aa sequence identity with the V-type I g domains of rat and human VSIG4, respectively.

Full Name
V-set and immunoglobulin domain containing 4
References
  • Vogt, L. et al., 2006, J Clin Invest.116: 2817-2826.
  • Helmy, K. et al., 2006, Cell. 124:915-927.
  • Wiesmann, C. et al., 2006, Nature. 444:217-220.
  • Zang,X. et al., 2006, J Clin Invest. 116: 2590-2593.
  • Katschke, KJ. et al., 2007, J. Exp. Med. 204:1319-1325.
  • He,JQ. et al., 2008, Mol Immunol. 45: 4041-4047.
  • VSIG4 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    VSIG4 cDNA ORF Clone in Cloning Vector, Mouse MG50187-M
    VSIG4 cDNA ORF Clone, Mouse, untagged MG50187-UT
    VSIG4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50187-ACGLN
    VSIG4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50187-ACG
    VSIG4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50187-ACR
    VSIG4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50187-CF
    VSIG4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50187-NF
    VSIG4 cDNA ORF Clone, Mouse, C-His tag MG50187-CH
    VSIG4 cDNA ORF Clone, Mouse, N-His tag MG50187-NH
    VSIG4 cDNA ORF Clone, Mouse, C-HA tag MG50187-CY
    VSIG4 cDNA ORF Clone, Mouse, N-HA tag MG50187-NY
    VSIG4 cDNA ORF Clone, Mouse, C-Myc tag MG50187-CM
    VSIG4 cDNA ORF Clone, Mouse, N-Myc tag MG50187-NM
    VSIG4 qPCR Primer Pairs, Mouse MP200217

    VSIG4 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    VSIG4 cDNA ORF Clone in Cloning Vector, Human HG12163-G
    VSIG4 cDNA ORF Clone, Human, untagged HG12163-UT
    VSIG4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12163-ACGLN
    VSIG4 cDNA ORF Clone, Human, C-GFPSpark® tag HG12163-ACG
    VSIG4 cDNA ORF Clone, Human, C-OFPSpark® tag HG12163-ACR
    VSIG4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12163-G-F
    VSIG4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12163-CF
    VSIG4 cDNA ORF Clone, Human, C-His tag HG12163-CH
    VSIG4 cDNA ORF Clone, Human, N-His tag HG12163-NH
    VSIG4 cDNA ORF Clone, Human, C-HA tag HG12163-CY
    VSIG4 cDNA ORF Clone, Human, N-HA tag HG12163-NY
    VSIG4 cDNA ORF Clone, Human, C-Myc tag HG12163-CM
    VSIG4 cDNA ORF Clone, Human, N-Myc tag HG12163-NM
    VSIG4 qPCR Primer Pairs, Human HP101797
    info info
    添加购物车成功! 添加购物车失败!