VNN2 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG11728-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All VNN2 Reagents
CRO Services
Product recommended

All VNN2 Reagents
VNN2 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1563 bp
Description
Full length Clone DNA of Human vanin 2 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

VNN2 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
FOAP-4 cDNA ORF Clone, Human;GPI-80 cDNA ORF Clone, Human;VNN2 cDNA ORF Clone, Human
VNN2 Background Information

Vascular non-inflammatory molecule 2, also known as glycosyl-phosphatidyl inositol-anchored protein GPI-80, Vanin-2, Protein FOAP-4 and VNN2, is a cell membrane protein which belongs to the CN hydrolase family and Vanin subfamily. VNN2 is widely expressed with higher expression in spleen and blood. VNN2 is a member of the vanin family of proteins which share extensive sequence similarity with each other, and also with biotinidase. The family includes secreted and membrane-associated proteins, a few of which have been reported to participate in hematopoietic cell trafficking. No biotinidase activity has been demonstrated for any of the vanin proteins, however, they possess pantetheinase activity, which may play a role in oxidative-stress response. VNN2 is an amidohydrolase that hydrolyzes specifically one of the carboamide linkages in D-pantetheine thus recycling pantothenic acid (vitamin B5) and releasing cysteamine. It is involved in the thymus homing of bone marrow cells. VNN2 plays a role in transendothelial migration of neutrophils and may regulate beta-2 integrin-mediated cell adhesion, migration and motility of neutrophil.

Full Name
vanin 2
References
  • Suzuki K. et al., 1999, J. Immunol. 162: 4277-84.
  • Martin, F. et al., 2001,Immunogenetics. 53 (4):296-306.
  • Liu T.et al., 2005, J. Proteome Res. 4: 2070-80.
  • Jansen P.AM. et al., 2009, J. Invest. Dermatol. 129: 2167-74.
  • info info
    添加购物车成功! 添加购物车失败!