VNN1 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG11662-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All VNN1 Reagents
CRO Services
Product recommended

All VNN1 Reagents
VNN1 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1542 bp
Description
Full length Clone DNA of Human vanin 1 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

VNN1 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
HDLCQ8 cDNA ORF Clone, Human;Tiff66 cDNA ORF Clone, Human
VNN1 Background Information

Pantetheinase, also known as Pantetheine hydrolase, Vascular non-inflammatory molecule 1, Vanin-1, and VNN1, is a cell membrane protein which belongs to the CN hydrolase family and BTD/VNN subfamily. Vanin-1 contains one CN hydrolase domain. It is widely expressed with higher expression in spleen, kidney and blood. It is overexpressed in lesional psoriatic skin. Vanin-1 is also a member of the Vanin family of proteins which share extensive sequence similarity with each other, and also with biotinidase. The family includes secreted and membrane-associated proteins, a few of which have been reported to participate in hematopoietic cell trafficking. No biotinidase activity has been demonstrated for any of the vanin proteins, however, they possess pantetheinase activity, which may play a role in oxidative-stress response. Vanin-1 is an epithelial pantetheinase that provides cysteamine to tissue and regulates response to stress. Vanin-1 is expressed by enterocytes, and its absence limits intestinal epithelial cell production of proinflammatory signals. Vanin-1 regulates late adhesion steps of thymus homing under physiological, noninflammatory conditions. The early impact of vanin-1 deficiency on tumor induction was directly correlated to the amount of inflammation and subsequent epithelial proliferation rather than cell death rate. Vanin-1 molecule was shown to be involved in the control of thymus reconstitution following sublethal irradiation.

Full Name
vanin 1
References
  • Aurrand-Lions M, et al. (1996) Vanin-1, a Novel GPI-Linked Perivascular Molecule Involved in Thymus Homing. Immunity. 5 (5): 391-405.
  • Grimmond S, et al. (2000) Sexually dimorphic expression of protease nexin-1 and vanin-1 in the developing mouse gonad prior to overt differentiation suggests a role in mammalian sexual development. Hum Mol Genet. 9 (10): 1553-60.
  • Meghari S, et al. (2007) Vanin-1 controls granuloma formation and macrophage polarization in Coxiella burnetii infection. Eur J Immunol. 37 (1): 24-32.
  • VNN1 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    VNN1 cDNA ORF Clone, Rat, untagged RG85658-UT
    VNN1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG85658-ACGLN
    VNN1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG85658-ACG
    VNN1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG85658-ACR
    VNN1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG85658-CF
    VNN1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG85658-NF
    VNN1 cDNA ORF Clone, Rat, C-His tag RG85658-CH
    VNN1 cDNA ORF Clone, Rat, N-His tag RG85658-NH
    VNN1 cDNA ORF Clone, Rat, C-HA tag RG85658-CY
    VNN1 cDNA ORF Clone, Rat, N-HA tag RG85658-NY
    VNN1 cDNA ORF Clone, Rat, C-Myc tag RG85658-CM
    VNN1 cDNA ORF Clone, Rat, N-Myc tag RG85658-NM

    VNN1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    VNN1 cDNA ORF Clone in Cloning Vector, Mouse MG50952-G
    VNN1 cDNA ORF Clone, Mouse, untagged MG50952-UT
    VNN1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50952-ACG
    VNN1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50952-ACGLN
    VNN1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50952-ACR
    VNN1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50952-CF
    VNN1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50952-NF
    VNN1 cDNA ORF Clone, Mouse, C-His tag MG50952-CH
    VNN1 cDNA ORF Clone, Mouse, N-His tag MG50952-NH
    VNN1 cDNA ORF Clone, Mouse, C-HA tag MG50952-CY
    VNN1 cDNA ORF Clone, Mouse, N-HA tag MG50952-NY
    VNN1 cDNA ORF Clone, Mouse, C-Myc tag MG50952-CM
    VNN1 cDNA ORF Clone, Mouse, N-Myc tag MG50952-NM
    VNN1 qPCR Primer Pairs, Mouse MP200921

    VNN1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    VNN1 cDNA ORF Clone in Cloning Vector, Human HG11662-M
    VNN1 cDNA ORF Clone, Human, untagged HG11662-UT
    VNN1 cDNA ORF Clone, Human, C-GFPSpark® tag HG11662-ACG
    VNN1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11662-ACGLN
    VNN1 cDNA ORF Clone, Human, C-OFPSpark® tag HG11662-ACR
    VNN1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11662-NF
    VNN1 cDNA ORF Clone, Human, C-His tag HG11662-CH
    VNN1 cDNA ORF Clone, Human, N-His tag HG11662-NH
    VNN1 cDNA ORF Clone, Human, C-HA tag HG11662-CY
    VNN1 cDNA ORF Clone, Human, N-HA tag HG11662-NY
    VNN1 cDNA ORF Clone, Human, C-Myc tag HG11662-CM
    VNN1 cDNA ORF Clone, Human, N-Myc tag HG11662-NM
    VNN1 qPCR Primer Pairs, Human HP101507
    info info
    添加购物车成功! 添加购物车失败!