VLDL Receptor cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG11075-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All VLDL Receptor Reagents
CRO Services
Product recommended

All VLDL Receptor Reagents
VLDL Receptor cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2622 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human very low density lipoprotein receptor with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Restriction Sites
KpnI + XbaI (6kb + 2.66kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
VLDL Receptor cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

VLDL Receptor cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
Human VLDLR Gene Expression validated Image 1697
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
other Green fluorescent protein / GFP Gene Plasmid Map 5609
VLDL Receptor cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
CAMRQ1 cDNA ORF Clone, Human;CARMQ1 cDNA ORF Clone, Human;CHRMQ1 cDNA ORF Clone, Human;VLDLRCH cDNA ORF Clone, Human
VLDL Receptor Background Information

The very low density lipoprotein receptor, known as VLDLR, is a single-pass type 1 integral membrance protein and a member of the LDL receptor family. This receptor family includes LDL receptor, LRP, megalin, VLDLR and ApoER2, and is characterized by a cluster of cysteine-rich class A repeats, epidermal growth factor (EGF)-like repeats, YWTD repeats and an O-linked sugar domain. VLDLR contains 3 EGF-like domains, 8 LDL-receptor class A domains, as well as 6 LDL-receptor class B repeats, and is abundant in heart, skeletal muscle, also ovary and kidney, but not in liver. VLDLR binds VLDL and transports it into cells by endocytosis. In order to be internalized, the receptor-ligand complexes must first cluster into clathrin-coated pits. VLDLR mediates the phosphorylation of mDab1 (mammalian disabled protein) via binding to Reelin, and induces the modulation of Tau phosphorylation. This pathway regulates the migration of neurons along the radial glial fiber network during brain development. Defects of VLDLR may be the cause of VLDLR-associated cerebellar hypoplasia (VLDLRCH), a syndrome characterized by moderate-to-profound mental retardation, delayed ambulation, and predominantly truncal ataxia.

Full Name
very low density lipoprotein receptor
References
  • Trommsdorff, M. et al., 1999. Cell. 97: 689-701.
  • Mikhailenko, I. et al., 1999. J. Cell Sci. 112: 3269-3281.
  • Sato, A. et al., 1999. Biochem. J. 341: 377-383.
  • Hiesberger, T. et al., 1999. Neuron 24: 481-489.
  • Tiebel, O. et al., 1999. Atherosclerosis 145: 239-251.
  • Boycott, K.M. et al., 2005, Am. J. Hum. Genet. 77 (3): 477-483. 
  • Moheb, L.A. et al., 2008, Eur. J. Hum. Genet. 16 (2): 270-273.
  • info info
    添加购物车成功! 添加购物车失败!