Text Size:AAA

Human VEGFR3/FLT-4 Gene ORF cDNA clone expression plasmid

  • Human VEGFR3 / FLT4 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
DatasheetReviewsRelated ProductsProtocols
Human FLT4 cDNA Clone Product Information
NCBI RefSeq:NM_002020.4
RefSeq ORF Size:3897bp
cDNA Description:Full length Clone DNA of Human fms-related tyrosine kinase 4.
Gene Synonym:PCL, FLT41, LMPH1A, VEGFR3, FLT4
Restriction Site:HindIII + XbaI (6.1kb + 3.9kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7( 5' TAATACGACTCACTATAGGG 3' )
( We provide with FLT4 qPCR primers for gene expression analysis, HP100911 )
Promoter:Enhanced CMV cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human FLT4 Gene Plasmid Map
Human VEGFR3 / FLT4 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name

Vascular endothelial growth factor receptor 3 (VEGFR3), also known as FLT-4, together with the other two members VEGFR1 (FLT-1) and VEGFR2 (KDR/Flk-1) are receptors for vascular endothelial growth factors (VEGF) and belong to the class III subfamily of receptor tyrosine kinases (RTKs). The VEGFR3 protein is expressed mainly on lymphatic vessels but it is also up-regulated in tumor angiogenesis. Mutations in VEGFR3 have been identified in patients with primary lymphoedema. The VEGF-C/VEGF-D/VEGFR3 signaling pathway may provide a target for antilymphangiogenic therapy in prostate cancer, breast cancer, gastric cancer, lung cancer, non-small cell lung cancer (NSCLC), and so on.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

  • Shushanov S, et al. (2000)VEGFc and VEGFR3 expression in human thyroid pathologies. Int J Cancer.86(1): 47-52.
  • Iljin K, et al. (2001) VEGFR3 gene structure, regulatory region, and sequence polymorphisms. FASEB J. 15(6): 1028-36.
  • Liu XE, et al. (2004) Expression and significance of VEGF-C and FLT-4 in gastric cancer. World J Gastroenterol. 10(3): 352-5.
  • Stearns ME, et al. (2004) Expression of a flt-4 (VEGFR3) splicing variant in primary human prostate tumors. VEGF D and flt-4t(Delta773-1081) overexpression is diagnostic for sentinel lymph node metastasis. Lab Invest. 84(6): 785-95.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.