Quick Order

Human VEGF/VEGFA/VEGF165 transcript variant 3 Gene ORF cDNA clone expression plasmid, N-HA tag

    DatasheetReviewsRelated ProductsProtocols
    Human VEGFA cDNA Clone Product Information
    NCBI RefSeq:NM_001171625.1
    RefSeq ORF Size:630bp
    cDNA Description:Full length Clone DNA of Homo sapiens vascular endothelial growth factor A (VEGFA), transcript variant 3 with N terminal HA tag.
    Gene Synonym:VPF, VEGF, VEGF-A
    Species:Human
    Vector:pCMV3-SP-N-HA
    Plasmid:
    Restriction Site:
    Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with VEGFA qPCR primers for gene expression analysis, HP100106 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Human VEGF/VEGFA/VEGF165 transcript variant 3 Gene ORF cDNA clone expression plasmid, N-HA tag on other vectors
    Product nameProduct name
    Background

    Vascular endothelial growth factor (VEGF), also known as vascular permeability factor (VPF) and VEGF-A, is a potent mediator of both angiogenesis and vasculogenesis in the fetus and adult. It is a member of the platelet-derived growth factor (PDGF)/vascular endothelial growth factor (VEGF) family and often exists as a disulfide-linked homodimer. VEGF-A protein is a glycosylated mitogen that specifically acts on endothelial cells and has various effects, including mediating increased vascular permeability, inducing angiogenesis, vasculogenesis and endothelial cell growth, promoting cell migration, inhibiting apoptosis and tumor growth. VEGF-A protein is also a vasodilator that increases microvascular permeability, thus it was originally referred to as vascular permeability factor.

    Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

    References
  • Woolard J. et al. (2004) VEGF165b, an inhibitory vascular endothelial growth factor splice variant: mechanism of action, in vivo effect on angiogenesis and endogenous protein expression. Cancer Res. 64(21): 7822-7835.
  • Jia SF, et al. (2008) VEGF165 is necessary to the metastatic potential of Fas(-) osteosarcoma cells but will not rescue the Fas(+) cells. J Exp Ther Oncol. 7(2): 89-97.
  • Cimpean AM, et al. (2008) Vascular endothelial growth factor A (VEGF A) as individual prognostic factor in invasive breast carcinoma. Rom J Morphol Embryol. 49(3): 303-8.
  • Hamdollah Zadeh MA, et al. (2008) VEGF-mediated elevated intracellular calcium and angiogenesis in human microvascular endothelial cells in vitro are inhibited by dominant negative TRPC6. Microcirculation. 15(7): 605-14.
  • Eisenach PA, et al. (2010) MT1-MMP regulates VEGF-A expression through a complex with VEGFR-2 and Src. J Cell Sci. 123(Pt 23):4182-4193.
  • Claesson-Welsh L (2010) Gremlin: vexing VEGF receptor agonist. Blood. 116(18):3386-7.
  • Size / Price
    Catalog: HG10009-NY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"