Quick Order

Human FIGF/VEGF-D Gene ORF cDNA clone expression plasmid, N-HA tag

DatasheetReviewsRelated ProductsProtocols
Human FIGF cDNA Clone Product Information
NCBI RefSeq:NM_004469.2
RefSeq ORF Size:1065bp
cDNA Description:Full length Clone DNA of Homo sapiens c-fos induced growth factor (vascular endothelial growth factor D) with N terminal HA tag.
Gene Synonym:VEGFD, VEGF-D
Species:Human
Vector:pCMV3-SP-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Vascular endothelial growth factor D (VEGF-D), also known as C-fos induced growth factor (FIGF), belongs to the platelet-derived growth factor/vascular endothelial growth factor (PDGF/VEGF) family. FIGF protein is active in angiogenesis, lymphangiogenesis, and endothelial cell growth. FIGF protein is secreted as a non-covelent homodimer in an antiparallel fashion. Human FIGF protein is expressed in adult lung, heart, muscle, and small intestine, and is most abundantly expressed in fetal lungs and skin. FIGF protein is structurally and functionally similar to VEGF-C. Therefore, FIGF protein binds and activates VEGFR-2 (Flk1) and VEGFR-3 (Flt4) receptors, and may particularly be involved in cancers, such as breast cancer, epithelial ovarian carcinoma and so on.

References
  • Avantaggiato V, et al. (1998) Embryonic expression pattern of the murine figf gene, a growth factor belonging to platelet-derived growth factor/vascular endothelial growth factor family. Mech Dev. 73(2):221-4.
  • Rocchigiani M, et al. (1998) Human FIGF: cloning, gene structure, and mapping to chromosome Xp22.1 between the PIGA and the GRPR genes. Genomics 47(2):207-16.
  • Karpanen T, et al. (2008) VEGF-D: a modifier of embryonic lymphangiogenesis. Blood. 112(5): 1547-8.
  • Size / Price
    Catalog: HG10557-NY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"