VDR cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human vitamin D (1,25- dihydroxyvitamin D3) receptor with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + XbaI (6kb + 1.32kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**
VDR cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
VDR cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
NR1I1 cDNA ORF Clone, Human;PPP1R163 cDNA ORF Clone, Human
VDR Background Information
VDR (vitamin D(1,25- dihydroxyvitamin D3)receptor), also known as NR1I1, belongs to the NR1I family, NR1 subfamily. It is composed of three domains: a modulating N-terminal domain, a DNA-binding domain and a C-terminal ligand-binding domain. Vitamin D receptors (VDRs) are members of the NR1I family, which also includes pregnane X (PXR) and constitutive androstane (CAR) receptors, that form heterodimers with members of the retinoid X receptor family. VDRs repress expression of 1alpha-hydroxylase (the proximal activator of 1,25(OH)2D3) and induce expression of the 1,25(OH)2D3 inactivating enzyme CYP24. Also, it has recently been identified as an additional bile acid receptor alongside FXR and may function to protect gut against the toxic and carcinogenic effects of these endobiotics. VDR is expressed in the intestine, thyroid and kidney and has a vital role in calcium homeostasis. It is the nuclear hormone receptor, also called transcription factor that mediates the action of vitamin D3. Inherited mutations in the VDR gene leads to rickets.
Full Name
vitamin D (1,25- dihydroxyvitamin D3) receptor
References
Moore DD, et al. (2006) The NR1H and NR1I receptors: constitutive androstane receptor, pregnene X receptor, farnesoid X receptor alpha, farnesoid X receptor beta, liver X receptor alpha, liver X receptor beta, and vitamin D receptor. Pharmacol Rev. 58(4):742-59.Szpirer J, et al. (1991)The Sp1 transcription factor gene (SP1) and the 1,25-dihydroxyvitamin D3 receptor gene (VDR) are colocalized on human chromosome arm 12q and rat chromosome 7. Genomics. 11(1):168-73.Germain P, et al. (2006) Overview of nomenclature of nuclear receptors. Pharmacol Rev. 58(4): 685-704.Adorini L, et al. (2006) Vitamin D receptor agonists, cancer and the immune system: an intricate relationship. Curr Top Med Chem. 6(12):1297-301.Luderer HF, et al. (2010) The vitamin D receptor, the skin and stem cells. J Steroid Biochem Mol Biol. 121(1-2):314-6.
