VASP cDNA ORF Clone, Human, C-Myc tag

Cat: HG14754-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All VASP Reagents
CRO Services
Product recommended

All VASP Reagents
VASP cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1143 bp
Description
Full length Clone DNA of Human vasodilator-stimulated phosphoprotein with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

VASP Background Information
Full Name
vasodilator-stimulated phosphoprotein

VASP cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
VASP cDNA ORF Clone in Cloning Vector, Mouse MG53411-U
VASP cDNA ORF Clone, Mouse, untagged MG53411-UT
VASP cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53411-ACG
VASP Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53411-ACGLN
VASP cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53411-ANG
VASP cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53411-ACR
VASP cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53411-ANR
VASP cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53411-CF
VASP cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53411-NF
VASP cDNA ORF Clone, Mouse, C-His tag MG53411-CH
VASP cDNA ORF Clone, Mouse, N-His tag MG53411-NH
VASP cDNA ORF Clone, Mouse, C-HA tag MG53411-CY
VASP cDNA ORF Clone, Mouse, N-HA tag MG53411-NY
VASP cDNA ORF Clone, Mouse, C-Myc tag MG53411-CM
VASP cDNA ORF Clone, Mouse, N-Myc tag MG53411-NM

VASP cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
VASP cDNA ORF Clone in Cloning Vector, Human HG14754-G
VASP cDNA ORF Clone, Human, untagged HG14754-UT
VASP Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14754-ACGLN
VASP cDNA ORF Clone, Human, C-GFPSpark® tag HG14754-ACG
VASP cDNA ORF Clone, Human, N-GFPSpark® tag HG14754-ANG
VASP cDNA ORF Clone, Human, C-OFPSpark® tag HG14754-ACR
VASP cDNA ORF Clone, Human, N-OFPSpark® tag HG14754-ANR
VASP cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14754-CF
VASP cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14754-NF
VASP cDNA ORF Clone, Human, C-His tag HG14754-CH
VASP cDNA ORF Clone, Human, N-His tag HG14754-NH
VASP cDNA ORF Clone, Human, C-HA tag HG14754-CY
VASP cDNA ORF Clone, Human, N-HA tag HG14754-NY
VASP cDNA ORF Clone, Human, N-Myc tag HG14754-NM
VASP qPCR Primer Pairs, Human HP103387
info info
添加购物车成功! 添加购物车失败!