Quick Order

Human VAPB/VAP-B Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Human VAPB cDNA Clone Product Information
NCBI RefSeq:NM_004738.3
RefSeq ORF Size:732bp
cDNA Description:Full length Clone DNA of Homo sapiens VAMP (vesicle-associated membrane protein)-associated protein B and C with N terminal His tag.
Gene Synonym:ALS8, VAP-B, VAP-C, VAMP-B, VAMP-C, VAPB
Species:Human
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Vesicle-associated membrane protein-associated protein B / C, also known as VAMP-B/VAMP-C, VAMP-associated protein B/C, VAP-B/VAP-C and VAPB, is a single-pass type IV membrane protein which belongs to the VAMP-associated protein ( VAP ) family. VAPB contains one MSP domain. VAPB may play a role in vesicle trafficking. VAPB forms a heterodimer with VAPA. VAPB interacts with VAMP1 and VAMP2. Defects in VAPB are the cause of amyotrophic lateral sclerosis type 8 ( ALS8 ) which is a familial form of amyotrophic lateral sclerosis, a neurodegenerative disorder affecting upper and lower motor neurons and resulting in fatal paralysis. Defects in VAPB are also a cause of spinal muscular atrophy autosomal dominant Finkel type ( SMAF ) which is characterized by proximal muscle weakness that begins in the lower limbs and then progresses to upper limbs.

References
  • Nishimura Y., et al., 1999, Biochem. Biophys. Res. Commun. 254:21-26.
  • Gevaert K., et al., 2003, Nat. Biotechnol. 21:566-569.
  • Hamamoto I., et al., 2005, J. Virol. 79:13473-13482.
  • Choudhary C. et al., 2009, Science 325:834-840.
  • Size / Price
    Catalog: HG10754-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"