Quick Order

Human VAPA Gene ORF cDNA clone expression plasmid, N-His tag

  • Ferret TNF-alpha/TNFA/TNFSF2 Gene Plasmid Map 5629
DatasheetReviewsRelated ProductsProtocols
Human VAPA cDNA Clone Product Information
NCBI RefSeq:NM_194434.2
RefSeq ORF Size:795 bp
cDNA Description:Full length Clone DNA of Homo sapiens VAMP (vesicle-associated membrane protein)-associated protein A, 33kDa with N terminal His tag.
Gene Synonym:VAP-A, VAP33, VAP-33, MGC3745, hVAP-33, VAPA
Species:Human
Vector:pCMV3-N-His
Plasmid:pCMV3-His-VAPA
Restriction Site:KpnI + XbaI(6kb+0.8kb)
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with VAPA qPCR primers for gene expression analysis, HP101290 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Flow cytometric analysis of Mouse IL6ST(CD130) expression on BABL/c splenocytes. Cells were stained with PE-conjugated anti-Mouse IL6ST(CD130) and FITC-conjugated anti-Mouse CD3. The dot plots were derived from gated events with the forward and side light-scatter characteristics of intact cells.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Size / Price
Catalog: HG11412-NH
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
AvailabilityIn Stock
Add to CartBulk Discount Inquiry

Datasheet & Documentation

Contact Us
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"