VAMP5 cDNA ORF Clone, Human, C-His tag

Cat: HG15277-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All VAMP5 Reagents
CRO Services
Product recommended

All VAMP5 Reagents
VAMP5 cDNA ORF Clone, Human, C-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
351 bp
Description
Full length Clone DNA of Human vesicle-associated membrane protein 5 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

VAMP5 Background Information
Full Name
vesicle-associated membrane protein 5

VAMP5 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
VAMP5 cDNA ORF Clone in Cloning Vector, Mouse MG52770-G
VAMP5 cDNA ORF Clone, Mouse, untagged MG52770-UT
VAMP5 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52770-ACGLN
VAMP5 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52770-ACG
VAMP5 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52770-ACR
VAMP5 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52770-CF
VAMP5 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52770-NF
VAMP5 cDNA ORF Clone, Mouse, C-His tag MG52770-CH
VAMP5 cDNA ORF Clone, Mouse, N-His tag MG52770-NH
VAMP5 cDNA ORF Clone, Mouse, C-HA tag MG52770-CY
VAMP5 cDNA ORF Clone, Mouse, N-HA tag MG52770-NY
VAMP5 cDNA ORF Clone, Mouse, C-Myc tag MG52770-CM
VAMP5 cDNA ORF Clone, Mouse, N-Myc tag MG52770-NM

VAMP5 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
VAMP5 cDNA ORF Clone in Cloning Vector, Human HG15277-G
VAMP5 cDNA ORF Clone, Human, untagged HG15277-UT
VAMP5 cDNA ORF Clone, Human, C-GFPSpark® tag HG15277-ACG
VAMP5 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15277-ACGLN
VAMP5 cDNA ORF Clone, Human, C-OFPSpark® tag HG15277-ACR
VAMP5 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15277-CF
VAMP5 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15277-NF
VAMP5 cDNA ORF Clone, Human, N-His tag HG15277-NH
VAMP5 cDNA ORF Clone, Human, C-HA tag HG15277-CY
VAMP5 cDNA ORF Clone, Human, N-HA tag HG15277-NY
VAMP5 cDNA ORF Clone, Human, C-Myc tag HG15277-CM
VAMP5 cDNA ORF Clone, Human, N-Myc tag HG15277-NM
VAMP5 qPCR Primer Pairs, Human HP103903
info info
添加购物车成功! 添加购物车失败!