After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human USH1C/Harmonin transcript variant 1 Gene ORF cDNA clone expression plasmid, C-HA tag

DatasheetReviewsRelated ProductsProtocols
Human USH1C cDNA Clone Product Information
NCBI RefSeq:NM_005709.2
RefSeq ORF Size:1659bp
cDNA Description:Full length Clone DNA of Homo sapiens Usher syndrome 1C (autosomal recessive, severe), transcript variant 1 with C terminal HA tag.
Gene Synonym:PDZ73, AIE-75, DFNB18, PDZ-45, PDZ-73, NY-CO-37, NY-CO-38, ush1cpst, PDZ-73/NY-CO-38
Species:Human
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Human USH1C/Harmonin transcript variant 1 Gene ORF cDNA clone expression plasmid, C-HA tag on other vectors
Human USH1C/Harmonin transcript variant 1 Gene ORF cDNA clone expression plasmid, C-GFPSpark tagHG10613-ACG$245
Human USH1C/Harmonin transcript variant 1 Gene ORF cDNA clone expression plasmid, C-OFPSpark tagHG10613-ACR$245
Human USH1C/Harmonin transcript variant 1 Gene ORF cDNA clone expression plasmid, N-GFPSpark tagHG10613-ANG$245
Human USH1C/Harmonin transcript variant 1 Gene ORF cDNA clone expression plasmid, N-OFPSpark tagHG10613-ANR$245
Human USH1C/Harmonin transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Flag tagHG10613-CF$215
Human USH1C/Harmonin transcript variant 1 Gene ORF cDNA clone expression plasmid, C-His tagHG10613-CH$215
Human USH1C/Harmonin transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Myc tagHG10613-CM$215
Human USH1C/Harmonin transcript variant 1 Gene ORF cDNA clone expression plasmid, C-HA tagHG10613-CY$215
Human USH1C/Harmonin transcript variant 1 Gene ORF cDNA clone in cloning vectorHG10613-M$75
Human USH1C/Harmonin transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Flag tagHG10613-M-F$215
Human USH1C/Harmonin transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Flag tagHG10613-NF$215
Human USH1C/Harmonin transcript variant 1 Gene ORF cDNA clone expression plasmid, N-His tagHG10613-NH$215
Human USH1C/Harmonin transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Myc tagHG10613-NM$215
Human USH1C/Harmonin transcript variant 1 Gene ORF cDNA clone expression plasmid, N-HA tagHG10613-NY$215
Human USH1C/Harmonin transcript variant 1 Gene ORF cDNA clone expression plasmidHG10613-UT$215
 Learn more about expression Vectors
Product nameProduct name
Background

Harmonin, also known as Antigen NY-CO-38 / NY-CO-37, Autoimmune enteropathy-related antigen AIE-75, Protein PDZ-73, Renal carcinoma antigen NY-REN-3, Usher syndrome type-1C protein and USH1C, is a protein which is expressed in small intestine, colon, kidney, eye and weakly in pancreas. USH1C is expressed also in vestibule of the inner ear. USH1C contains 3 PDZ (DHR) domains. USH1C may be involved in protein-protein interaction. Defects in USH1C are the cause of Usher syndrome type 1C (USH1C), also known as Usher syndrome type I Acadian variety. USH is a genetically heterogeneous condition characterized by the association of retinitis pigmentosa and sensorineural deafness. Age at onset and differences in auditory and vestibular function distinguish Usher syndrome type 1 (USH1), Usher syndrome type 2 (USH2) and Usher syndrome type 3 (USH3). Defects in USH1C are also the cause of deafness autosomal recessive type 18 (DFNB18) which is a form of sensorineural hearing loss. Sensorineural deafness results from damage to the neural receptors of the inner ear, the nerve pathways to the brain, or the area of the brain that receives sound information.

References
  • Verpy, E. et al., 2000, Nat Genet. 26 (1):51-5.
  • Weil D., et al., 2003, Hum. Mol. Genet. 12:463-471.
  • Reiners,J. et al., 2005, Hum Mol Genet. 14 (24):3933-43.
  • Yan,D. et al., 2006, Mol Biol. 357 (3):755-64.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"