UROS cDNA ORF Clone, Human, N-His tag

Cat: HG14342-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All UROS Reagents
CRO Services
Product recommended

All UROS Reagents
UROS cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
798 bp
Description
Full length Clone DNA of Human uroporphyrinogen III synthase with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

UROS cDNA ORF Clone, Human, N-His tag Alternative Names
UROIIIS cDNA ORF Clone, Human
UROS Background Information
Full Name
uroporphyrinogen III synthase

UROS cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
UROS cDNA ORF Clone in Cloning Vector, Mouse MG51924-G
UROS cDNA ORF Clone, Mouse, untagged MG51924-UT
UROS cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51924-ACG
UROS Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51924-ACGLN
UROS cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51924-ANG
UROS cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51924-ACR
UROS cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51924-ANR
UROS cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51924-CF
UROS cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51924-NF
UROS cDNA ORF Clone, Mouse, C-His tag MG51924-CH
UROS cDNA ORF Clone, Mouse, N-His tag MG51924-NH
UROS cDNA ORF Clone, Mouse, C-HA tag MG51924-CY
UROS cDNA ORF Clone, Mouse, N-HA tag MG51924-NY
UROS cDNA ORF Clone, Mouse, C-Myc tag MG51924-CM
UROS cDNA ORF Clone, Mouse, N-Myc tag MG51924-NM
UROS qPCR Primer Pairs, Mouse MP201797

UROS cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
UROS cDNA ORF Clone in Cloning Vector, Human HG14342-G
UROS cDNA ORF Clone, Human, untagged HG14342-UT
UROS Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14342-ACGLN
UROS cDNA ORF Clone, Human, C-GFPSpark® tag HG14342-ACG
UROS cDNA ORF Clone, Human, N-GFPSpark® tag HG14342-ANG
UROS cDNA ORF Clone, Human, C-OFPSpark® tag HG14342-ACR
UROS cDNA ORF Clone, Human, N-OFPSpark® tag HG14342-ANR
UROS cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14342-CF
UROS cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14342-NF
UROS cDNA ORF Clone, Human, C-His tag HG14342-CH
UROS cDNA ORF Clone, Human, C-HA tag HG14342-CY
UROS cDNA ORF Clone, Human, N-HA tag HG14342-NY
UROS cDNA ORF Clone, Human, C-Myc tag HG14342-CM
UROS cDNA ORF Clone, Human, N-Myc tag HG14342-NM
UROS qPCR Primer Pairs, Human HP102992
info info
添加购物车成功! 添加购物车失败!