UQCRC1 cDNA ORF Clone, Human, untagged

Cat: HG16163-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All UQCRC1 Reagents
CRO Services
Product recommended

All UQCRC1 Reagents
UQCRC1 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1443 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human ubiquinol-cytochrome c reductase core protein I.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Restriction Sites
KpnI+NotI(6.1kb+1.44kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
UQCRC1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

UQCRC1 cDNA ORF Clone, Human, untagged Validated Images
Human IL12A / IL-12A Gene Plasmid Map 5647
UQCRC1 cDNA ORF Clone, Human, untagged Alternative Names
D3S3191 cDNA ORF Clone, Human;QCR1 cDNA ORF Clone, Human;UQCR1 cDNA ORF Clone, Human
UQCRC1 Background Information
Full Name
ubiquinol-cytochrome c reductase core protein I

UQCRC1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
UQCRC1 cDNA ORF Clone in Cloning Vector, Rat RG80648-U
UQCRC1 cDNA ORF Clone, Rat, untagged RG80648-UT
UQCRC1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80648-ACG
UQCRC1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80648-ACGLN
UQCRC1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80648-ANG
UQCRC1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80648-ACR
UQCRC1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80648-ANR
UQCRC1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80648-CF
UQCRC1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80648-NF
UQCRC1 cDNA ORF Clone, Rat, C-His tag RG80648-CH
UQCRC1 cDNA ORF Clone, Rat, N-His tag RG80648-NH
UQCRC1 cDNA ORF Clone, Rat, C-HA tag RG80648-CY
UQCRC1 cDNA ORF Clone, Rat, N-HA tag RG80648-NY
UQCRC1 cDNA ORF Clone, Rat, C-Myc tag RG80648-CM
UQCRC1 cDNA ORF Clone, Rat, N-Myc tag RG80648-NM
UQCRC1 qPCR Primer Pairs, Rat RP300612

UQCRC1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
UQCRC1 cDNA ORF Clone in Cloning Vector, Mouse MG51768-G
UQCRC1 cDNA ORF Clone, Mouse, untagged MG51768-UT
UQCRC1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51768-ACG
UQCRC1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51768-ACGLN
UQCRC1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51768-ANG
UQCRC1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51768-ACR
UQCRC1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51768-ANR
UQCRC1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51768-CF
UQCRC1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51768-NF
UQCRC1 cDNA ORF Clone, Mouse, C-His tag MG51768-CH
UQCRC1 cDNA ORF Clone, Mouse, N-His tag MG51768-NH
UQCRC1 cDNA ORF Clone, Mouse, C-HA tag MG51768-CY
UQCRC1 cDNA ORF Clone, Mouse, N-HA tag MG51768-NY
UQCRC1 cDNA ORF Clone, Mouse, C-Myc tag MG51768-CM
UQCRC1 cDNA ORF Clone, Mouse, N-Myc tag MG51768-NM
UQCRC1 qPCR Primer Pairs, Mouse MP201641

UQCRC1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
UQCRC1 cDNA ORF Clone in Cloning Vector, Human HG16163-G
UQCRC1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16163-ACGLN
UQCRC1 cDNA ORF Clone, Human, C-GFPSpark® tag HG16163-ACG
UQCRC1 cDNA ORF Clone, Human, N-GFPSpark® tag HG16163-ANG
UQCRC1 cDNA ORF Clone, Human, C-OFPSpark® tag HG16163-ACR
UQCRC1 cDNA ORF Clone, Human, N-OFPSpark® tag HG16163-ANR
UQCRC1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16163-CF
UQCRC1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16163-NF
UQCRC1 cDNA ORF Clone, Human, C-His tag HG16163-CH
UQCRC1 cDNA ORF Clone, Human, N-His tag HG16163-NH
UQCRC1 cDNA ORF Clone, Human, C-HA tag HG16163-CY
UQCRC1 cDNA ORF Clone, Human, N-HA tag HG16163-NY
UQCRC1 cDNA ORF Clone, Human, C-Myc tag HG16163-CM
UQCRC1 cDNA ORF Clone, Human, N-Myc tag HG16163-NM
UQCRC1 qPCR Primer Pairs, Human HP104932
info info
添加购物车成功! 添加购物车失败!