UNG cDNA ORF Clone, Human, N-HA tag

Cat: HG12117-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All UNG Reagents
CRO Services
Product recommended

All UNG Reagents
UNG cDNA ORF Clone, Human, N-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
915 bp
Description
Full length Clone DNA of Human uracil-DNA.glycosylase, transcript variant 1 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

UNG cDNA ORF Clone, Human, N-HA tag Alternative Names
DGU cDNA ORF Clone, Human;HIGM4 cDNA ORF Clone, Human;HIGM5 cDNA ORF Clone, Human;UDG cDNA ORF Clone, Human;UNG1 cDNA ORF Clone, Human;UNG15 cDNA ORF Clone, Human;UNG2 cDNA ORF Clone, Human
UNG Background Information

Isoform 1 is widely expressed with the highest expression in skeletal muscle, heart and testicles. Isoform 2 has the highest expression levels in tissues containing proliferating cells. Uracil-DNA glycosylase exists in two forms: mitochondrial uracil-DNA glycosylase 1 (UNG1) and nuclear uracil-DNA glycosylase 2 (UNG2). uracil-DNA glycosylase. This gene encodes one of several uracil-DNA glycosylases. One important function of uracil-DNA glycosylases is to prevent mutagenesis by eliminating uracil from DNA molecules by cleaving the N-glycosylic bond and initiating the base-excision repair (BER) pathway. Uracil bases occur from cytosine deamination or misincorporation of dUMP residues. Alternative promoter usage and splicing of this gene leads to two different isoforms: the mitochondrial UNG1 and the nuclear UNG2. The UNG2 term was used as a previous symbol for the CCNO gene (GeneID 10309), which has been confused with this gene, in the literature and some databases. Defects in UNG are a cause of immunodeficiency with hyper-IgM type 5 (HIGM5). A rare immunodeficiency syndrome characterized by normal or elevated serum IgM levels with absence of IgG, IgA, and IgE. It results in a profound susceptibility to bacterial infections.

Full Name
uracil-DNA glycosylase
References
  • Akbari M, et al. (2007) Different organization of base excision repair of uracil in DNA in nuclei and mitochondria and selective upregulation of mitochondrial uracil-DNA glycosylase after oxidative stress. Neuroscience. 145(4):1201-12.
  • Slupphaug G, et al. (1996) Properties of a recombinant human uracil-DNA glycosylase from the UNG gene and evidence that UNG encodes the major uracil-DNA glycosylase. Biochemistry. 34(1): 128-38.
  • Pytel D, et al. (2008) Uracil-DNA glycosylases. Postepy Biochem. 54(4): 362-70.
  • info info
    添加购物车成功! 添加购物车失败!