Quick Order

Human UNG transcript variant 1 natural ORF mammalian expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human UNG cDNA Clone Product Information
NCBI RefSeq:NM_003362.2
RefSeq ORF Size:915bp
cDNA Description:Full length Clone DNA of Homo sapiens uracil-DNA.glycosylase, transcript variant 1.
Gene Synonym:DGU, UDG, UNG1, UNG2, HIGM4, UNG15, DKFZp781L1143, UNG
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Isoform 1 is widely expressed with the highest expression in skeletal muscle, heart and testicles. Isoform 2 has the highest expression levels in tissues containing proliferating cells. Uracil-DNA glycosylase exists in two forms: mitochondrial uracil-DNA glycosylase 1 (UNG1) and nuclear uracil-DNA glycosylase 2 (UNG2). uracil-DNA glycosylase. This gene encodes one of several uracil-DNA glycosylases. One important function of uracil-DNA glycosylases is to prevent mutagenesis by eliminating uracil from DNA molecules by cleaving the N-glycosylic bond and initiating the base-excision repair (BER) pathway. Uracil bases occur from cytosine deamination or misincorporation of dUMP residues. Alternative promoter usage and splicing of this gene leads to two different isoforms: the mitochondrial UNG1 and the nuclear UNG2. The UNG2 term was used as a previous symbol for the CCNO gene (GeneID 10309), which has been confused with this gene, in the literature and some databases. Defects in UNG are a cause of immunodeficiency with hyper-IgM type 5 (HIGM5). A rare immunodeficiency syndrome characterized by normal or elevated serum IgM levels with absence of IgG, IgA, and IgE. It results in a profound susceptibility to bacterial infections.

References
  • Akbari M, et al. (2007) Different organization of base excision repair of uracil in DNA in nuclei and mitochondria and selective upregulation of mitochondrial uracil-DNA glycosylase after oxidative stress. Neuroscience. 145(4):1201-12.
  • Slupphaug G, et al. (1996) Properties of a recombinant human uracil-DNA glycosylase from the UNG gene and evidence that UNG encodes the major uracil-DNA glycosylase. Biochemistry. 34(1): 128-38.
  • Pytel D, et al. (2008) Uracil-DNA glycosylases. Postepy Biochem. 54(4): 362-70.
  • Size / Price
    Catalog: HG12117-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability
     Shipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"