After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human ULBP2 Gene ORF cDNA clone expression plasmid, C-His tag

DatasheetReviewsRelated ProductsProtocols
Human ULBP2 cDNA Clone Product Information
NCBI RefSeq:BC034689
RefSeq ORF Size:741bp
cDNA Description:Full length Clone DNA of Homo sapiens UL16 binding protein 2 with C terminal His tag.
Gene Synonym:N2DL2, RAET1H, ULBP2
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

NKG2D ligand 2, also known as N2DL-2, NKG2DL2, ALCAN-alpha, Retinoic acid early transcript 1H, UL16-binding protein 2, ULBP2 and N2DL2, is cell membrane protein which belongs to the MHC class I family. ULBP2 / N2DL-2 is expressed in various types of cancer cell lines and in the fetus, but not in normal tissues. ULBP2 / N2DL-2 is a ligand for the NKG2D receptor, together with at least ULBP1 and ULBP3. ULBPs activate multiple signaling pathways in primary NK cells, resulting in the production of cytokines and chemokines. Binding of ULBPs ligands to NKG2D induces calcium mobilization and activation of the JAK2, STAT5, ERK and PI3K kinase/Akt signal transduction pathway.

References
  • Cosman D. et al., 2001,Immunity 14:123-133
  • Cerwenka A., et al., 2003, Tissue Antigens 61:335-343
  • Chang,Y.T. et al., 2011, PLoS One. 6 (5):e20029
  • Size / Price
    Catalog: HG12143-CH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"