ULBP1 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG10679-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ULBP1 Reagents
CRO Services
Product recommended

All ULBP1 Reagents
ULBP1 cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
735 bp
Description
Full length Clone DNA of Human UL16 binding protein 1 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ULBP1 cDNA ORF Clone, Human, N-DDK (Flag®) tag Validated Images
Human ULBP1 Gene Expression validated Image 16536
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF02). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
ULBP1 cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names
RAET1I cDNA ORF Clone, Human
ULBP1 Background Information

UL16-binding proteins (ULBP) or retinoic acid early transcripts-1 (RAET1) are ligands to the activating receptor, NKG2D. Ten members of the human ULBP/RAET1 gene family have been identified to encode for potentially functional proteins, and have tissue-specific expressions. ULBP1, also known as RAET1I and NKG2DL1, together with at least ULBP 2 and 3, are well-known ligands for NKG2D, and activate multiple signaling pathways in primary NK cells, resulting in the production of cytokines and chemokines. ULBP1 is expressed in T-cells, B-cells, erythroleukemia cell lines and in a wide range of tissues including heart, brain, lung, liver and bone marrow, as well as some tumor cells. As an unconventional member of the MHC class I family, ULBP1 function in immune responses, especially in cancer and infectious diseases. Unlike other ULBP members, ULBP1 is able to interact with soluble CMV glycoprotein UL16 in CMV infected cells. The interaction with UL16 blocked the interaction with the NKG2D receptor, and thus might escape the immune surveillance. Furthermore, UL16 also causes ULBP1 to be retained in the ER and cis-Golgi apparatus so that it does not reach the cell surface. The ULBP1 regulation may have implications for development of new therapeutic strategies against cancer cells.

Full Name
UL16 binding protein 1
References

1.  Rölle, A. et al., 2003, J Immunol. 171(2): 902-908.  

2.  López-Soto, A. et al., 2006, J Biol Chem. 281(41): 30419-30430.      

3.  Song, H. et al., 2006, Cell Immunol. 239(1): 22-30.  

4.  Eisele, G. et al., 2006, Brain. 129 (9): 2416-2425.   

5.  Romphruk, AV. et al., 2009, Immunogenetics. 61(9): 611-617. 

6.  Sutherland, C.L. et. al., 2002, J. Immunol. 168: 671-679.

ULBP1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ULBP1 cDNA ORF Clone in Cloning Vector, Mouse MG5A3227-G
ULBP1 cDNA ORF Clone, Mouse, untagged MG5A3227-UT
ULBP1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A3227-ACGLN
ULBP1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A3227-ACG
ULBP1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A3227-ACR
ULBP1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A3227-CF
ULBP1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A3227-NF
ULBP1 cDNA ORF Clone, Mouse, C-His tag MG5A3227-CH
ULBP1 cDNA ORF Clone, Mouse, N-His tag MG5A3227-NH
ULBP1 cDNA ORF Clone, Mouse, C-HA tag MG5A3227-CY
ULBP1 cDNA ORF Clone, Mouse, N-HA tag MG5A3227-NY
ULBP1 cDNA ORF Clone, Mouse, C-Myc tag MG5A3227-CM
ULBP1 cDNA ORF Clone, Mouse, N-Myc tag MG5A3227-NM

ULBP1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ULBP1 cDNA ORF Clone in Cloning Vector, Human HG10679-M
ULBP1 cDNA ORF Clone, Human, untagged HG10679-UT
ULBP1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10679-ACG
ULBP1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10679-ACGLN
ULBP1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10679-ACR
ULBP1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10679-CF
ULBP1 cDNA ORF Clone, Human, C-His tag HG10679-CH
ULBP1 cDNA ORF Clone, Human, N-His tag HG10679-NH
ULBP1 cDNA ORF Clone, Human, C-HA tag HG10679-CY
ULBP1 cDNA ORF Clone, Human, N-HA tag HG10679-NY
ULBP1 cDNA ORF Clone, Human, C-Myc tag HG10679-CM
ULBP1 cDNA ORF Clone, Human, N-Myc tag HG10679-NM
ULBP1 qPCR Primer Pairs, Human HP100876
info info
添加购物车成功! 添加购物车失败!