After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human ULBP1 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human ULBP1 cDNA Clone Product Information
NCBI RefSeq:NM_025218.2
RefSeq ORF Size:735bp
cDNA Description:Full length Clone DNA of Homo sapiens UL16 binding protein 1.
Gene Synonym:RAET1I, ULBP1
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-ULBP1
Restriction Site:KpnI + XbaI (6.1kb + 0.74kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human ULBP1 Gene Plasmid Map
Human ULBP-1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Background

UL16-binding proteins (ULBP) or retinoic acid early transcripts-1 (RAET1) are ligands to the activating receptor, NKG2D. Ten members of the human ULBP/RAET1 gene family have been identified to encode for potentially functional proteins, and have tissue-specific expressions. ULBP1, also known as RAET1I and NKG2DL1, together with at least ULBP 2 and 3, are well-known ligands for NKG2D, and activate multiple signaling pathways in primary NK cells, resulting in the production of cytokines and chemokines. ULBP1 is expressed in T-cells, B-cells, erythroleukemia cell lines and in a wide range of tissues including heart, brain, lung, liver and bone marrow, as well as some tumor cells. As an unconventional member of the MHC class I family, ULBP1 function in immune responses, especially in cancer and infectious diseases. Unlike other ULBP members, ULBP1 is able to interact with soluble CMV glycoprotein UL16 in CMV infected cells. The interaction with UL16 blocked the interaction with the NKG2D receptor, and thus might escape the immune surveillance. Furthermore, UL16 also causes ULBP1 to be retained in the ER and cis-Golgi apparatus so that it does not reach the cell surface. The ULBP1 regulation may have implications for development of new therapeutic strategies against cancer cells.

References

1.  Rölle, A. et al., 2003, J Immunol. 171(2): 902-908.  

2.  López-Soto, A. et al., 2006, J Biol Chem. 281(41): 30419-30430.      

3.  Song, H. et al., 2006, Cell Immunol. 239(1): 22-30.  

4.  Eisele, G. et al., 2006, Brain. 129 (9): 2416-2425.   

5.  Romphruk, AV. et al., 2009, Immunogenetics. 61(9): 611-617. 

6.  Sutherland, C.L. et. al., 2002, J. Immunol. 168: 671-679.

Size / Price
Catalog: HG10679-UT
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
AvailabilityIn Stock
Bulk Discount InquiryAdd to Cart
Contact Us
Images
  • Human ULBP-1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"