UCP2 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG16428-NF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All UCP2 Reagents
CRO Services
Product recommended

All UCP2 Reagents
UCP2 cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
966 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human uncoupling protein 2 (mitochondrial, proton carrier) with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Restriction Sites
KpnI + XbaI(6kb+0.97kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
UCP2 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

UCP2 cDNA ORF Clone, Human, N-DDK (Flag®) tag Validated Images
Human aFGF/FGF1 Gene Plasmid Map 5637
UCP2 cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names
BMIQ4 cDNA ORF Clone, Human;SLC25A8 cDNA ORF Clone, Human;UCPH cDNA ORF Clone, Human
UCP2 Background Information
Full Name
uncoupling protein 2 (mitochondrial, proton carrier)

UCP2 cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
UCP2 cDNA ORF Clone in Cloning Vector, Ferret FG60053-G
UCP2 cDNA ORF Clone, Ferret, untagged FG60053-UT
UCP2 Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60053-ACGLN
UCP2 cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60053-ACG
UCP2 cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60053-ACR
UCP2 cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60053-CF
UCP2 cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60053-NF
UCP2 cDNA ORF Clone, Ferret, C-His tag FG60053-CH
UCP2 cDNA ORF Clone, Ferret, N-His tag FG60053-NH
UCP2 cDNA ORF Clone, Ferret, C-HA tag FG60053-CY
UCP2 cDNA ORF Clone, Ferret, N-HA tag FG60053-NY
UCP2 cDNA ORF Clone, Ferret, C-Myc tag FG60053-CM
UCP2 cDNA ORF Clone, Ferret, N-Myc tag FG60053-NM

UCP2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
UCP2 cDNA ORF Clone in Cloning Vector, Mouse MG53900-U
UCP2 cDNA ORF Clone, Mouse, untagged MG53900-UT
UCP2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53900-ACGLN
UCP2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53900-ACG
UCP2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53900-ANG
UCP2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53900-ACR
UCP2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53900-ANR
UCP2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53900-CF
UCP2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53900-NF
UCP2 cDNA ORF Clone, Mouse, C-His tag MG53900-CH
UCP2 cDNA ORF Clone, Mouse, N-His tag MG53900-NH
UCP2 cDNA ORF Clone, Mouse, C-HA tag MG53900-CY
UCP2 cDNA ORF Clone, Mouse, N-HA tag MG53900-NY
UCP2 cDNA ORF Clone, Mouse, C-Myc tag MG53900-CM
UCP2 cDNA ORF Clone, Mouse, N-Myc tag MG53900-NM

UCP2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
UCP2 cDNA ORF Clone in Cloning Vector, Human HG16428-G
UCP2 cDNA ORF Clone, Human, untagged HG16428-UT
UCP2 cDNA ORF Clone, Human, C-GFPSpark® tag HG16428-ACG
UCP2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16428-ACGLN
UCP2 cDNA ORF Clone, Human, N-GFPSpark® tag HG16428-ANG
UCP2 cDNA ORF Clone, Human, C-OFPSpark® tag HG16428-ACR
UCP2 cDNA ORF Clone, Human, N-OFPSpark® tag HG16428-ANR
UCP2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16428-CF
UCP2 cDNA ORF Clone, Human, C-His tag HG16428-CH
UCP2 cDNA ORF Clone, Human, N-His tag HG16428-NH
UCP2 cDNA ORF Clone, Human, C-HA tag HG16428-CY
UCP2 cDNA ORF Clone, Human, N-HA tag HG16428-NY
UCP2 cDNA ORF Clone, Human, C-Myc tag HG16428-CM
UCP2 cDNA ORF Clone, Human, N-Myc tag HG16428-NM
UCP2 qPCR Primer Pairs, Human HP105177
info info
添加购物车成功! 添加购物车失败!