UCHL5 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG16407-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All UCHL5 Reagents
CRO Services
Product recommended

All UCHL5 Reagents
UCHL5 cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
990 bp
Description
Full length Clone DNA of Human ubiquitin carboxyl-terminal hydrolase L5 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

UCHL5 cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names
CGI-70 cDNA ORF Clone, Human;INO80R cDNA ORF Clone, Human;UCH-L5 cDNA ORF Clone, Human;UCH37 cDNA ORF Clone, Human
UCHL5 Background Information
Full Name
ubiquitin C-terminal hydrolase L5

UCHL5 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
UCHL5 cDNA ORF Clone in Cloning Vector, Mouse MG52709-U
UCHL5 cDNA ORF Clone, Mouse, untagged MG52709-UT
UCHL5 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52709-ACG
UCHL5 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52709-ACGLN
UCHL5 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52709-ANG
UCHL5 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52709-ACR
UCHL5 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52709-ANR
UCHL5 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52709-CF
UCHL5 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52709-NF
UCHL5 cDNA ORF Clone, Mouse, C-His tag MG52709-CH
UCHL5 cDNA ORF Clone, Mouse, N-His tag MG52709-NH
UCHL5 cDNA ORF Clone, Mouse, C-HA tag MG52709-CY
UCHL5 cDNA ORF Clone, Mouse, N-HA tag MG52709-NY
UCHL5 cDNA ORF Clone, Mouse, C-Myc tag MG52709-CM
UCHL5 cDNA ORF Clone, Mouse, N-Myc tag MG52709-NM
UCHL5 qPCR Primer Pairs, Mouse MP202580

UCHL5 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
UCHL5 cDNA ORF Clone in Cloning Vector, Human HG16407-G
UCHL5 cDNA ORF Clone, Human, untagged HG16407-UT
UCHL5 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16407-ACGLN
UCHL5 cDNA ORF Clone, Human, C-GFPSpark® tag HG16407-ACG
UCHL5 cDNA ORF Clone, Human, N-GFPSpark® tag HG16407-ANG
UCHL5 cDNA ORF Clone, Human, C-OFPSpark® tag HG16407-ACR
UCHL5 cDNA ORF Clone, Human, N-OFPSpark® tag HG16407-ANR
UCHL5 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16407-CF
UCHL5 cDNA ORF Clone, Human, C-His tag HG16407-CH
UCHL5 cDNA ORF Clone, Human, N-His tag HG16407-NH
UCHL5 cDNA ORF Clone, Human, C-HA tag HG16407-CY
UCHL5 cDNA ORF Clone, Human, N-HA tag HG16407-NY
UCHL5 cDNA ORF Clone, Human, C-Myc tag HG16407-CM
UCHL5 cDNA ORF Clone, Human, N-Myc tag HG16407-NM
UCHL5 qPCR Primer Pairs, Human HP105156
info info
添加购物车成功! 添加购物车失败!