UBXN6 cDNA ORF Clone, Human, N-HA tag

Cat: HG14755-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All UBXN6 Reagents
CRO Services
Product recommended

All UBXN6 Reagents
UBXN6 cDNA ORF Clone, Human, N-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1167 bp
Description
Full length Clone DNA of Human UBX domain protein 6 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

UBXN6 cDNA ORF Clone, Human, N-HA tag Alternative Names
UBXD1 cDNA ORF Clone, Human;UBXDC2 cDNA ORF Clone, Human
UBXN6 Background Information
Full Name
UBX domain protein 6

UBXN6 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
UBXN6 cDNA ORF Clone in Cloning Vector, Mouse MG52763-G
UBXN6 cDNA ORF Clone, Mouse, untagged MG52763-UT
UBXN6 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52763-ACG
UBXN6 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52763-ACGLN
UBXN6 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52763-ANG
UBXN6 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52763-ACR
UBXN6 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52763-ANR
UBXN6 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52763-CF
UBXN6 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52763-NF
UBXN6 cDNA ORF Clone, Mouse, C-His tag MG52763-CH
UBXN6 cDNA ORF Clone, Mouse, N-His tag MG52763-NH
UBXN6 cDNA ORF Clone, Mouse, C-HA tag MG52763-CY
UBXN6 cDNA ORF Clone, Mouse, N-HA tag MG52763-NY
UBXN6 cDNA ORF Clone, Mouse, C-Myc tag MG52763-CM
UBXN6 cDNA ORF Clone, Mouse, N-Myc tag MG52763-NM

UBXN6 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
UBXN6 cDNA ORF Clone in Cloning Vector, Human HG14755-G
UBXN6 cDNA ORF Clone, Human, untagged HG14755-UT
UBXN6 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14755-ACGLN
UBXN6 cDNA ORF Clone, Human, C-GFPSpark® tag HG14755-ACG
UBXN6 cDNA ORF Clone, Human, N-GFPSpark® tag HG14755-ANG
UBXN6 cDNA ORF Clone, Human, C-OFPSpark® tag HG14755-ACR
UBXN6 cDNA ORF Clone, Human, N-OFPSpark® tag HG14755-ANR
UBXN6 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14755-CF
UBXN6 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14755-NF
UBXN6 cDNA ORF Clone, Human, C-His tag HG14755-CH
UBXN6 cDNA ORF Clone, Human, N-His tag HG14755-NH
UBXN6 cDNA ORF Clone, Human, C-HA tag HG14755-CY
UBXN6 cDNA ORF Clone, Human, C-Myc tag HG14755-CM
UBXN6 cDNA ORF Clone, Human, N-Myc tag HG14755-NM
UBXN6 qPCR Primer Pairs, Human HP103388
info info
添加购物车成功! 添加购物车失败!