UBXN1 cDNA ORF Clone, Human, N-HA tag

Cat: HG14098-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All UBXN1 Reagents
CRO Services
Product recommended

All UBXN1 Reagents
UBXN1 cDNA ORF Clone, Human, N-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
939 bp
Description
Full length Clone DNA of Human UBX domain protein 1 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

UBXN1 cDNA ORF Clone, Human, N-HA tag Alternative Names
2B28 cDNA ORF Clone, Human;SAKS1 cDNA ORF Clone, Human;UBXD10 cDNA ORF Clone, Human
UBXN1 Background Information
Full Name
UBX domain protein 1

UBXN1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
UBXN1 cDNA ORF Clone in Cloning Vector, Mouse MG5A3861-U
UBXN1 cDNA ORF Clone, Mouse, untagged MG5A3861-UT
UBXN1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A3861-ACG
UBXN1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A3861-ACGLN
UBXN1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A3861-ANG
UBXN1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A3861-ACR
UBXN1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A3861-ANR
UBXN1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A3861-CF
UBXN1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A3861-NF
UBXN1 cDNA ORF Clone, Mouse, C-His tag MG5A3861-CH
UBXN1 cDNA ORF Clone, Mouse, N-His tag MG5A3861-NH
UBXN1 cDNA ORF Clone, Mouse, C-HA tag MG5A3861-CY
UBXN1 cDNA ORF Clone, Mouse, N-HA tag MG5A3861-NY
UBXN1 cDNA ORF Clone, Mouse, C-Myc tag MG5A3861-CM
UBXN1 cDNA ORF Clone, Mouse, N-Myc tag MG5A3861-NM

UBXN1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
UBXN1 cDNA ORF Clone in Cloning Vector, Human HG14098-G
UBXN1 cDNA ORF Clone, Human, untagged HG14098-UT
UBXN1 cDNA ORF Clone, Human, C-GFPSpark® tag HG14098-ACG
UBXN1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14098-ACGLN
UBXN1 cDNA ORF Clone, Human, N-GFPSpark® tag HG14098-ANG
UBXN1 cDNA ORF Clone, Human, C-OFPSpark® tag HG14098-ACR
UBXN1 cDNA ORF Clone, Human, N-OFPSpark® tag HG14098-ANR
UBXN1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14098-CF
UBXN1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14098-NF
UBXN1 cDNA ORF Clone, Human, C-His tag HG14098-CH
UBXN1 cDNA ORF Clone, Human, N-His tag HG14098-NH
UBXN1 cDNA ORF Clone, Human, C-HA tag HG14098-CY
UBXN1 cDNA ORF Clone, Human, C-Myc tag HG14098-CM
UBXN1 cDNA ORF Clone, Human, N-Myc tag HG14098-NM
UBXN1 qPCR Primer Pairs, Human HP102751
info info
添加购物车成功! 添加购物车失败!