UbcH6 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG12003-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All UbcH6 Reagents
CRO Services
Product recommended

All UbcH6 Reagents
UbcH6 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
621 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human ubiquitin-conjugating enzyme E2E 1 (UBC4/5 homolog, yeast) with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Restriction Sites
KpnI + XbaI(6kb+0.62kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
UbcH6 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

UbcH6 cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5609
UbcH6 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
UBCH6 cDNA ORF Clone, Human
UbcH6 Background Information

Ubiquitin-conjugating enzyme E2E1 (UBE2E1) is a member of the ubiquitin-donjugating enzyme family. UBE2E1 is a protein localized to the nucleus. The modification of proteins with ubiquitin is an importantly step for targeting abnormal or short-lived proteins for degeneration. It has been demonstrated to be released to Sjogrens's syndrome and systemic lupus Erythematosus. Patients with the systemic autoimmune diseases Sjogrens's syndrome and systemic lupus erythematosus often have autoantibodies against the intracellular protein Ro52 that is an E3 ligase dependent on the ubiquitin conjugation enzymes UBE2E1. Ro52 mediates ubiquitination through UBE2D1 in the cytoplasm and through UBE2E1 in the nucleus.

Full Name
ubiquitin-conjugating enzyme E2E 1
References
  • Nuber U, et al. (1996) Cloning of human ubiquitin-conjugating enzymes UbcH6 and UbcH7 (E2-F1) and characterization of their interaction with E6-AP and RSP5. J Biol Chem. 271(5): 2795-800.
  • Espinosa A, et al. (2008) The autoantigen Ro52 is an E3 ligase resident in the cytoplasm but enters the nucleus upon cellular exposure to nitric oxide. Exp Cell Res. 314(20): 3605-13.
  • Anan T, et al. (1998) Human ubiquitin-protein ligase Nedd4: expression, subcellular localization and selective interaction with ubiquitin-conjugating enzymes. Genes Cells. 3(11): 751-63.
  • info info
    添加购物车成功! 添加购物车失败!