UBAC2 cDNA ORF Clone, Human, C-His tag

Cat: HG15819-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All UBAC2 Reagents
CRO Services
Product recommended

All UBAC2 Reagents
UBAC2 cDNA ORF Clone, Human, C-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
696 bp
Description
Full length Clone DNA of Human UBA domain containing 2 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

UBAC2 cDNA ORF Clone, Human, C-His tag Alternative Names
PHGDHL1 cDNA ORF Clone, Human
UBAC2 Background Information
Full Name
UBA domain containing 2

UBAC2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
UBAC2 cDNA ORF Clone in Cloning Vector, Mouse MG53745-U
UBAC2 cDNA ORF Clone, Mouse, untagged MG53745-UT
UBAC2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53745-ACG
UBAC2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53745-ACGLN
UBAC2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53745-ACR
UBAC2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53745-CF
UBAC2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53745-NF
UBAC2 cDNA ORF Clone, Mouse, C-His tag MG53745-CH
UBAC2 cDNA ORF Clone, Mouse, N-His tag MG53745-NH
UBAC2 cDNA ORF Clone, Mouse, C-HA tag MG53745-CY
UBAC2 cDNA ORF Clone, Mouse, N-HA tag MG53745-NY
UBAC2 cDNA ORF Clone, Mouse, C-Myc tag MG53745-CM
UBAC2 cDNA ORF Clone, Mouse, N-Myc tag MG53745-NM

UBAC2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
UBAC2 cDNA ORF Clone in Cloning Vector, Human HG15819-G
UBAC2 cDNA ORF Clone, Human, untagged HG15819-UT
UBAC2 cDNA ORF Clone, Human, C-GFPSpark® tag HG15819-ACG
UBAC2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15819-ACGLN
UBAC2 cDNA ORF Clone, Human, C-OFPSpark® tag HG15819-ACR
UBAC2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15819-CF
UBAC2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15819-NF
UBAC2 cDNA ORF Clone, Human, N-His tag HG15819-NH
UBAC2 cDNA ORF Clone, Human, C-HA tag HG15819-CY
UBAC2 cDNA ORF Clone, Human, N-HA tag HG15819-NY
UBAC2 cDNA ORF Clone, Human, C-Myc tag HG15819-CM
UBAC2 cDNA ORF Clone, Human, N-Myc tag HG15819-NM
UBAC2 qPCR Primer Pairs, Human HP104410
info info
添加购物车成功! 添加购物车失败!